Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

IFIH1 cdna clone

IFIH1 cDNA Clone

Gene Names
IFIH1; AGS7; Hlcd; MDA5; MDA-5; RLR-2; IDDM19; SGMRT1
Synonyms
IFIH1; IFIH1 cDNA Clone; IFIH1 cdna clone
Ordering
For Research Use Only!
Sequence
atgtcgaatgggtattccacagacgagaatttccgctatctcatctcgtgcttcagggccagggtgaaaatgtacatccaggtggagcctgtgctggactacctgacctttctgcctgcagaggtgaaggagcagattcagaggacagtcgccacctccgggaacatgcaggcagttgaactgctgctgagcaccttggagaagggagtctggcaccttggttggactcgggaattcgtggaggccctccggagaaccggcagccctctggccgcccgctacatgaaccctgagctcacggacttgccctctccatcgtttgagaacgctcatgatgaatatctccaactgctgaacctccttcagcccactctggtggacaagcttctagttagagacgtcttggataagtgcatggaggaggaactgttgacaattgaagacagaaaccggattgctgctgcagaaaacaatggaaatgaatcaggtgtaagagagctactaaaaaggattgtgcagaaagaaaactggttctctgcatttctgaatgttcttcgtcaaacaggaaacaatgaacttgtccaagagttaacaggctctgattgctcagaaagcaatgcaggtatttgtaattttactgaggaagattcttcaaattctgcctag
Sequence Length
666
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
25,129 Da
NCBI Official Full Name
Homo sapiens interferon induced with helicase C domain 1, mRNA
NCBI Official Synonym Full Names
interferon induced with helicase C domain 1
NCBI Official Symbol
IFIH1
NCBI Official Synonym Symbols
AGS7; Hlcd; MDA5; MDA-5; RLR-2; IDDM19; SGMRT1
NCBI Protein Information
interferon-induced helicase C domain-containing protein 1
UniProt Protein Name
Interferon-induced helicase C domain-containing protein 1
UniProt Gene Name
IFIH1
UniProt Synonym Gene Names
MDA5; RH116; CADM-140 autoantigen; Helicard; MDA-5; RLR-2
UniProt Entry Name
IFIH1_HUMAN

NCBI Description

DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein that is upregulated in response to treatment with beta-interferon and a protein kinase C-activating compound, mezerein. Irreversible reprogramming of melanomas can be achieved by treatment with both these agents; treatment with either agent alone only achieves reversible differentiation. Genetic variation in this gene is associated with diabetes mellitus insulin-dependent type 19. [provided by RefSeq, Jul 2012]

Uniprot Description

IFIH1: Innate immune receptor which acts as a cytoplasmic sensor of viral nucleic acids and plays a major role in sensing viral infection and in the activation of a cascade of antiviral responses including the induction of type I interferons and proinflammatory cytokines. Its ligands include mRNA lacking 2'-O- methylation at their 5' cap and long-dsRNA (>1 kb in length). Upon ligand binding it associates with mitochondria antiviral signaling protein (MAVS/IPS1) which activates the IKK-related kinases: TBK1 and IKBKE which phosphorylate interferon regulatory factors: IRF3 and IRF7 which in turn activate transcription of antiviral immunological genes, including interferons (IFNs); IFN-alpha and IFN-beta. Responsible for detecting the Picornaviridae family members such as encephalomyocarditis virus (EMCV) and mengo encephalomyocarditis virus (ENMG). Can also detect other viruses such as dengue virus (DENV), west Nile virus (WNV), and reovirus. Also involved in antiviral signaling in response to viruses containing a dsDNA genome, such as vaccinia virus. Plays an important role in amplifying innate immune signaling through recognition of RNA metabolites that are produced during virus infection by ribonuclease L (RNase L). May play an important role in enhancing natural killer cell function and may be involved in growth inhibition and apoptosis in several tumor cell lines. Monomer in the absence of ligands and homodimerizes in the presence of dsRNA ligands. Can assemble into helical or linear polymeric filaments on long dsRNA. Interacts with MAVS/IPS1. Interacts with V protein of Simian virus 5, Human parainfluenza virus 2, Mumps virus, Sendai virus and Hendra virus. Binding to paramyxoviruses V proteins prevents IFN-beta induction, and the further establishment of an antiviral state. Interacts with PCBP2. Interacts with NLRC5. Interacts with PIAS2-beta. Interacts with DDX60. By interferon (IFN) and TNF. Widely expressed, at a low level. Expression is detected at slightly highest levels in placenta, pancreas and spleen and at barely levels in detectable brain, testis and lung. Belongs to the helicase family. RLR subfamily. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Helicase; Apoptosis; EC 3.6.4.13

Chromosomal Location of Human Ortholog: 2q24

Cellular Component: cytosol

Molecular Function: double-stranded RNA binding; protein binding; ribonucleoprotein binding; single-stranded RNA binding; zinc ion binding

Biological Process: detection of virus; innate immune response; negative regulation of interferon type I production; positive regulation of interferon-alpha production; positive regulation of interferon-beta production; protein sumoylation; response to virus

Disease: Aicardi-goutieres Syndrome 7; Singleton-merten Syndrome 1

Research Articles on IFIH1

Similar Products

Product Notes

The IFIH1 ifih1 (Catalog #AAA1274101) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcgaatg ggtattccac agacgagaat ttccgctatc tcatctcgtg cttcagggcc agggtgaaaa tgtacatcca ggtggagcct gtgctggact acctgacctt tctgcctgca gaggtgaagg agcagattca gaggacagtc gccacctccg ggaacatgca ggcagttgaa ctgctgctga gcaccttgga gaagggagtc tggcaccttg gttggactcg ggaattcgtg gaggccctcc ggagaaccgg cagccctctg gccgcccgct acatgaaccc tgagctcacg gacttgccct ctccatcgtt tgagaacgct catgatgaat atctccaact gctgaacctc cttcagccca ctctggtgga caagcttcta gttagagacg tcttggataa gtgcatggag gaggaactgt tgacaattga agacagaaac cggattgctg ctgcagaaaa caatggaaat gaatcaggtg taagagagct actaaaaagg attgtgcaga aagaaaactg gttctctgca tttctgaatg ttcttcgtca aacaggaaac aatgaacttg tccaagagtt aacaggctct gattgctcag aaagcaatgc aggtatttgt aattttactg aggaagattc ttcaaattct gcctag. It is sometimes possible for the material contained within the vial of "IFIH1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.