IFI44L cdna clone
IFI44L cDNA Clone
Gene Names
IFI44L; GS3686; C1orf29
Synonyms
IFI44L; IFI44L cDNA Clone; IFI44L cdna clone
Sequence
atggttgaaagatgcagccgtcagggatgtactataacaatggcttacattgattacaatatgattgtagcctttatgcttggaaattatattaatttacatgaaagttctacagagccaaatgattccctatggttttcacttcaaaagaaaaatgacaccactgaaatagaaactttactcttaaatacagcaccaaaaattattgatgagcaactggtgtgtcgtttatcgaaaacggatattttcattatatgtcgagataataaaatttatctagataaaatgataacaagaaacttgaaactaaggttttatggccaccgtcagtatttggaatgtgaagtttttcgagttgaaggaattaaggataacctagacgacataaagaggataattaaagccagagagcacagaaataggcttctagcagacatcagagactataggccctatgcagacttggtttcagaaattcgtattcttttggtgggtccagttgggtctggaaagtccagttttttcaattcagtcaagtctatttttcatggccatgtgactggccaagccgtagtggggtctgatatcaccagcataaccgagcggtataggatatattctgttaaagatggaaaaaatggaaaatctctgccatttatgttgtgtgacactatggggctagatggggcagaaggagcaggactgtgcatggatgacattccccacatcttaaaaggttgtatgccagacagatatcagtttaattcccgtaaaccaattacacctgagcattctacttttatcacctctccatctctgaaggacaggattcactgtgtggcttatgtcttagacatcaactctattgacaatctctactctaaaatgttggcaaaagtgaagcaagttcacaaagaagtattaaactgtggtatagcatatgtggccttgcttactaaagtggatgattgcagtgaggttcttcaagacaactttttaaacatgagtagatctatgacttctcaaagccgggtcatgaatgtccataaaatgctaggcattcctatttccaatattttgatggttggaaactatgcttcagatttggaactggaccccatgaaggatattctcatcctctctgcactgaggcagatgctgcgggctgcagatgattttttagaagatttgcctcttgaggaaactggtgcaattgagagagcgttacagccctgcatttga
Sequence Length
1242
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
18,825 Da
NCBI Official Full Name
Homo sapiens interferon-induced protein 44-like, mRNA
NCBI Official Synonym Full Names
interferon induced protein 44 like
NCBI Official Symbol
IFI44L
NCBI Official Synonym Symbols
GS3686; C1orf29
NCBI Protein Information
interferon-induced protein 44-like
UniProt Protein Name
Interferon-induced protein 44-like
Protein Family
UniProt Gene Name
IFI44L
UniProt Synonym Gene Names
C1orf29
UniProt Entry Name
IF44L_HUMAN
Uniprot Description
IFI44L: Exhibits a low antiviral activity against hepatitis C virus. Belongs to the IFI44 family. 2 isoforms of the human protein are produced by alternative splicing.
Chromosomal Location of Human Ortholog: 1p31.1
Cellular Component: nucleoplasm
Research Articles on IFI44L
Similar Products
Product Notes
The IFI44L ifi44l (Catalog #AAA1269361) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggttgaaa gatgcagccg tcagggatgt actataacaa tggcttacat tgattacaat atgattgtag cctttatgct tggaaattat attaatttac atgaaagttc tacagagcca aatgattccc tatggttttc acttcaaaag aaaaatgaca ccactgaaat agaaacttta ctcttaaata cagcaccaaa aattattgat gagcaactgg tgtgtcgttt atcgaaaacg gatattttca ttatatgtcg agataataaa atttatctag ataaaatgat aacaagaaac ttgaaactaa ggttttatgg ccaccgtcag tatttggaat gtgaagtttt tcgagttgaa ggaattaagg ataacctaga cgacataaag aggataatta aagccagaga gcacagaaat aggcttctag cagacatcag agactatagg ccctatgcag acttggtttc agaaattcgt attcttttgg tgggtccagt tgggtctgga aagtccagtt ttttcaattc agtcaagtct atttttcatg gccatgtgac tggccaagcc gtagtggggt ctgatatcac cagcataacc gagcggtata ggatatattc tgttaaagat ggaaaaaatg gaaaatctct gccatttatg ttgtgtgaca ctatggggct agatggggca gaaggagcag gactgtgcat ggatgacatt ccccacatct taaaaggttg tatgccagac agatatcagt ttaattcccg taaaccaatt acacctgagc attctacttt tatcacctct ccatctctga aggacaggat tcactgtgtg gcttatgtct tagacatcaa ctctattgac aatctctact ctaaaatgtt ggcaaaagtg aagcaagttc acaaagaagt attaaactgt ggtatagcat atgtggcctt gcttactaaa gtggatgatt gcagtgaggt tcttcaagac aactttttaa acatgagtag atctatgact tctcaaagcc gggtcatgaa tgtccataaa atgctaggca ttcctatttc caatattttg atggttggaa actatgcttc agatttggaa ctggacccca tgaaggatat tctcatcctc tctgcactga ggcagatgct gcgggctgca gatgattttt tagaagattt gcctcttgag gaaactggtg caattgagag agcgttacag ccctgcattt ga. It is sometimes possible for the material contained within the vial of "IFI44L, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
