Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

IFI30 cdna clone

IFI30 cDNA Clone

Gene Names
IFI30; GILT; IP30; IP-30; IFI-30
Synonyms
IFI30; IFI30 cDNA Clone; IFI30 cdna clone
Ordering
For Research Use Only!
Sequence
atgaccctgtcgccacttctgctgttcctgccaccgctgctgctgctgctggacgtccccacggcggcggtgcaggcgtcccctctgcaagcgttagacttctttgggaatgggccaccagttaactacaagacaggcaatctatacctgcgggggcccctgaagaagtccaatgcaccgcttgtcaatgtgaccctctactatgaagcactgtgcggtggctgccaagccttcctgatccgggagctcttcccaacatggctgttggtcatggagatcctcaatgtcacgctggtgccctacggaaacgcacaggaacaaaatgtcagtggcaggtgggagttcaagtgccagcatggagaagaggagtgcaaattcaacaaggtggaggcctgcgtgttggatgaacttgacatggagctagccttcctgaccattgtctgcatggaagagtttgaggacatggagagaagtctgccactatgcctgcagctctacgccccagggctgtcgccagacactatcatggagtgtgcaatgggggaccgcggcatgcagctcatgcacgccaacgcccagcggacagatgctctccagccaccgcacgagtatgtgccctgggtcaccgtcaatgggaaacccttggaagatcagacccagctccttacccttgtctgccagttgtaccagggcaagaagccggatgtctgcccttcctcaaccagctccctcaggagtgtttgcttcaagtga
Sequence Length
753
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
27,964 Da
NCBI Official Full Name
Homo sapiens interferon, gamma-inducible protein 30, mRNA
NCBI Official Synonym Full Names
IFI30, lysosomal thiol reductase
NCBI Official Symbol
IFI30
NCBI Official Synonym Symbols
GILT; IP30; IP-30; IFI-30
NCBI Protein Information
gamma-interferon-inducible lysosomal thiol reductase
UniProt Protein Name
Gamma-interferon-inducible lysosomal thiol reductase
UniProt Gene Name
IFI30
UniProt Synonym Gene Names
GILT; IP30
UniProt Entry Name
GILT_HUMAN

NCBI Description

The protein encoded by this gene is a lysosomal thiol reductase that at low pH can reduce protein disulfide bonds. The enzyme is expressed constitutively in antigen-presenting cells and induced by gamma-interferon in other cell types. This enzyme has an important role in MHC class II-restricted antigen processing. [provided by RefSeq, Jul 2008]

Uniprot Description

IFI30: Lysosomal thiol reductase that can reduce protein disulfide bonds. May facilitate the complete unfolding of proteins destined for lysosomal degradation. Plays an important role in antigen processing. Facilitates the generation of MHC class II- restricted epitodes from disulfide bond-containing antigen by the endocytic reduction of disulfide bonds. Facilitates also MHC class I-restricted recognition of exogenous antigens containing disulfide bonds by CD8+ T-cells or crosspresentation. Belongs to the GILT family.

Protein type: Secreted; Secreted, signal peptide; EC 1.8.-.-

Chromosomal Location of Human Ortholog: 19p13.1

Cellular Component: cell junction; cytoplasm; intracellular membrane-bound organelle; lysosomal lumen; lysosome; plasma membrane

Molecular Function: oxidoreductase activity, acting on sulfur group of donors; protein binding

Biological Process: antigen processing and presentation of exogenous peptide antigen via MHC class I; antigen processing and presentation of exogenous peptide antigen via MHC class II

Research Articles on IFI30

Similar Products

Product Notes

The IFI30 ifi30 (Catalog #AAA1275859) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaccctgt cgccacttct gctgttcctg ccaccgctgc tgctgctgct ggacgtcccc acggcggcgg tgcaggcgtc ccctctgcaa gcgttagact tctttgggaa tgggccacca gttaactaca agacaggcaa tctatacctg cgggggcccc tgaagaagtc caatgcaccg cttgtcaatg tgaccctcta ctatgaagca ctgtgcggtg gctgccaagc cttcctgatc cgggagctct tcccaacatg gctgttggtc atggagatcc tcaatgtcac gctggtgccc tacggaaacg cacaggaaca aaatgtcagt ggcaggtggg agttcaagtg ccagcatgga gaagaggagt gcaaattcaa caaggtggag gcctgcgtgt tggatgaact tgacatggag ctagccttcc tgaccattgt ctgcatggaa gagtttgagg acatggagag aagtctgcca ctatgcctgc agctctacgc cccagggctg tcgccagaca ctatcatgga gtgtgcaatg ggggaccgcg gcatgcagct catgcacgcc aacgcccagc ggacagatgc tctccagcca ccgcacgagt atgtgccctg ggtcaccgtc aatgggaaac ccttggaaga tcagacccag ctccttaccc ttgtctgcca gttgtaccag ggcaagaagc cggatgtctg cccttcctca accagctccc tcaggagtgt ttgcttcaag tga. It is sometimes possible for the material contained within the vial of "IFI30, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.