Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HTR3A cdna clone

HTR3A cDNA Clone

Gene Names
HTR3A; HTR3; 5HT3R; 5-HT-3; 5-HT3A; 5-HT3R
Synonyms
HTR3A; HTR3A cDNA Clone; HTR3A cdna clone
Ordering
For Research Use Only!
Sequence
atgctgctgtgggtccagcaggcgctgctcgccttgctcctccccacactcctggcacagggagaagccaggaggagccgaaacaccaccaggcccgctctgctgaggctgtcggattaccttttgaccaactacaggaagggtgtgcgccccgtgagggactggaggaagccaaccaccgtatccattgacgtcattgtctatgccatcctcaacgtggatgagaagaatcaggtgctgaccacctacatctggtaccggcagtactggactgatgagtttctccagtggaaccctgaggactttgacaacatcaccaagttgtccatccccacggacagcatctgggtcccggacattctcatcaatgagttcgtggatgtggggaagtctccaaatatcccgtacgtgtatattcggcatcaaggcgaagttcagaactacaagccccttcaggtggtgactgcctgtagcctcgacatctacaacttccccttcgatgtccagaactgctcgctgaccttcaccagttggctgcacaccatccaggacatcaacatctctttgtggcgcttgccagaaaaggtgaaatccgacaggagtgtcttcatgaaccagggagagtgggagttgctgggggtgctgccctactttcgggagttcagcatggaaagcagtaactactatgcagaaatgaagttctatgtggtcatccgccggcggcccctcttctatgtggtcagcctgctactgcccagcatcttcctcatggtcatggacatcgtgggcttctacctgccccccaacagtggcgagagggtctctttcaagattacactcctcctgggctactcggtcttcctgatcatcgtttctgacacgctgccggccactgccatcggcactcctctcattggtgtctactttgtggtgtgcatggctctgctggtgataagtttggccgagaccatcttcattgtgcggctggtgcacaagcaagacctgcagcagcccgtgcctgcttggctgcgtcacctggttctggagagaatcgcctggctactttgcctgagggagcagtcaacttcccagaggcccccagccacctcccaagccaccaagactgatgactgctcagccatgggaaaccactgcagccacatgggaggaccccaggacttcgagaagagcccgagggacagatgtagccctcccccaccacctcgggaggcctcgctggcggtgtgtgggctgctgcaggagctgtcctccatccggcaattcctggaaaagcgggatgagatccgagaggtggcccgagactggctgcgcgtgggctccgtgctggacaagctgctattccacatttacctgctggcggtgctggcctacagcatcaccctggttatgctctggtccatctggcagtacgcttga
Sequence Length
1437
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
59,002 Da
NCBI Official Full Name
Homo sapiens 5-hydroxytryptamine (serotonin) receptor 3A, mRNA
NCBI Official Synonym Full Names
5-hydroxytryptamine receptor 3A
NCBI Official Symbol
HTR3A
NCBI Official Synonym Symbols
HTR3; 5HT3R; 5-HT-3; 5-HT3A; 5-HT3R
NCBI Protein Information
5-hydroxytryptamine receptor 3A
UniProt Protein Name
5-hydroxytryptamine receptor 3A
UniProt Gene Name
HTR3A
UniProt Synonym Gene Names
5HT3R; HTR3; 5-HT3-A; 5-HT3A; 5-HT-3; 5-HT3R
UniProt Entry Name
5HT3A_HUMAN

NCBI Description

The product of this gene belongs to the ligand-gated ion channel receptor superfamily. This gene encodes subunit A of the type 3 receptor for 5-hydroxytryptamine (serotonin), a biogenic hormone that functions as a neurotransmitter, a hormone, and a mitogen. This receptor causes fast, depolarizing responses in neurons after activation. It appears that the heteromeric combination of A and B subunits is necessary to provide the full functional features of this receptor, since either subunit alone results in receptors with very low conductance and response amplitude. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]

Uniprot Description

5-HT(3): This is one of the several different receptors for 5- hydroxytryptamine (serotonin), a biogenic hormone that functions as a neurotransmitter, a hormone, and a mitogen. This receptor is a ligand-gated ion channel, which when activated causes fast, depolarizing responses in neurons. It is a cation-specific, but otherwise relatively nonselective, ion channel. Belongs to the ligand-gated ion channel (TC 1.A.9) family. 5-hydroxytryptamine receptor (TC 1.A.9.2) subfamily. HTR3A sub-subfamily. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: Channel, cation; Membrane protein, integral; Channel, ligand-gated; Membrane protein, multi-pass; Transporter, ion channel

Chromosomal Location of Human Ortholog: 11q23.1

Cellular Component: nicotinic acetylcholine-gated receptor-channel complex; plasma membrane

Molecular Function: acetylcholine binding; acetylcholine receptor activity; nicotinic acetylcholine-activated cation-selective channel activity; protein binding; serotonin binding; serotonin-activated cation-selective channel activity; serotonin-gated cation channel activity

Biological Process: synaptic transmission, cholinergic

Research Articles on HTR3A

Similar Products

Product Notes

The HTR3A htr3a (Catalog #AAA1277625) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgctgt gggtccagca ggcgctgctc gccttgctcc tccccacact cctggcacag ggagaagcca ggaggagccg aaacaccacc aggcccgctc tgctgaggct gtcggattac cttttgacca actacaggaa gggtgtgcgc cccgtgaggg actggaggaa gccaaccacc gtatccattg acgtcattgt ctatgccatc ctcaacgtgg atgagaagaa tcaggtgctg accacctaca tctggtaccg gcagtactgg actgatgagt ttctccagtg gaaccctgag gactttgaca acatcaccaa gttgtccatc cccacggaca gcatctgggt cccggacatt ctcatcaatg agttcgtgga tgtggggaag tctccaaata tcccgtacgt gtatattcgg catcaaggcg aagttcagaa ctacaagccc cttcaggtgg tgactgcctg tagcctcgac atctacaact tccccttcga tgtccagaac tgctcgctga ccttcaccag ttggctgcac accatccagg acatcaacat ctctttgtgg cgcttgccag aaaaggtgaa atccgacagg agtgtcttca tgaaccaggg agagtgggag ttgctggggg tgctgcccta ctttcgggag ttcagcatgg aaagcagtaa ctactatgca gaaatgaagt tctatgtggt catccgccgg cggcccctct tctatgtggt cagcctgcta ctgcccagca tcttcctcat ggtcatggac atcgtgggct tctacctgcc ccccaacagt ggcgagaggg tctctttcaa gattacactc ctcctgggct actcggtctt cctgatcatc gtttctgaca cgctgccggc cactgccatc ggcactcctc tcattggtgt ctactttgtg gtgtgcatgg ctctgctggt gataagtttg gccgagacca tcttcattgt gcggctggtg cacaagcaag acctgcagca gcccgtgcct gcttggctgc gtcacctggt tctggagaga atcgcctggc tactttgcct gagggagcag tcaacttccc agaggccccc agccacctcc caagccacca agactgatga ctgctcagcc atgggaaacc actgcagcca catgggagga ccccaggact tcgagaagag cccgagggac agatgtagcc ctcccccacc acctcgggag gcctcgctgg cggtgtgtgg gctgctgcag gagctgtcct ccatccggca attcctggaa aagcgggatg agatccgaga ggtggcccga gactggctgc gcgtgggctc cgtgctggac aagctgctat tccacattta cctgctggcg gtgctggcct acagcatcac cctggttatg ctctggtcca tctggcagta cgcttga. It is sometimes possible for the material contained within the vial of "HTR3A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.