Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HTR2B cdna clone

HTR2B cDNA Clone

Gene Names
HTR2B; 5-HT2B; 5-HT-2B; 5-HT(2B)
Synonyms
HTR2B; HTR2B cDNA Clone; HTR2B cdna clone
Ordering
For Research Use Only!
Sequence
atggctctctcttacagagtgtctgaacttcaaagcacaattcctgagcacattttgcagagcacctttgttcacgttatctcttctaactggtctggattacagacagaatcaataccagaggaaatgaaacagattgttgaggaacagggaaataaactgcactgggcagctcttctgatactcatggtgataatacccacaattggtggaaatacccttgttattctggctgtttcactggagaagaagctgcagtatgctactaattactttctaatgtccttggcggtggctgatttgctggttggattgtttgtgatgccaattgccctcttgacaataatgtttgaggctatgtggcccctcccacttgttctatgtcctgcctggttatttcttgacgttctcttttcaaccgcatccatcatgcatctctgtgccatttcagtggatcgttacatagccatcaaaaagccaatccaggccaatcaatataactcacgggctacagcattcatcaagattacagtggtgtggttaatttcaataggcattgccattccagtccctattaaagggatagagactgatgtggacaacccaaacaatatcacttgtgtgctgacaaaggaacgttttggcgatttcatgctctttggctcactggctgccttcttcacacctcttgcaattatgattgtcacctactttctcactatccatgctttacagaagaaggcttacttagtcaaaaacaagccacctcaacgcctaacatggttgactgtgtctacagttttccaaagggatgaaacaccttgctcgtcaccggaaaaggtggcaatgctggatggttctcgaaaggacaaggctctgcccaactcaggtgatgaaacacttatgcgaagaacatccacaattgggaaaaagtcagtgcagaccatttccaacgaacagagagcctcaaaggtcctagggattgtgtttttcctctttttgcttatgtggtgtcccttctttattacaaatataactttagttttatgtgattcctgtaaccaaactactctccaaatgctcctggagatatttgtgtggataggctatgtttcctcaggagtgaatcctttggtctacaccctcttcaataagacatttcgggatgcatttggccgatatatcacctgcaattaccgggccacaaagtcagtaaaaactctcagaaaacgctccagtaagatctacttccggaatccaatggcagagaactctaagtttttcaagaaacatggaattcgaaatgggattaaccctgccatgtaccagagtccaatgaggctccgaagttcaaccattcagtcttcatcaatcattctactagatacgcttctcctcactgaaaatgaaggtgacaaaactgaagagcgagttagttatgtatag
Sequence Length
1446
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
54,298 Da
NCBI Official Full Name
Homo sapiens 5-hydroxytryptamine (serotonin) receptor 2B, mRNA
NCBI Official Synonym Full Names
5-hydroxytryptamine receptor 2B
NCBI Official Symbol
HTR2B
NCBI Official Synonym Symbols
5-HT2B; 5-HT-2B; 5-HT(2B)
NCBI Protein Information
5-hydroxytryptamine receptor 2B
UniProt Protein Name
5-hydroxytryptamine receptor 2B
UniProt Gene Name
HTR2B
UniProt Synonym Gene Names
5-HT-2B; 5-HT2B
UniProt Entry Name
5HT2B_HUMAN

NCBI Description

This gene encodes one of the several different receptors for 5-hydroxytryptamine (serotonin) that belongs to the G-protein coupled receptor 1 family. Serotonin is a biogenic hormone that functions as a neurotransmitter, a hormone, and a mitogen. Serotonin receptors mediate many of the central and peripheral physiologic functions of serotonin, including regulation of cardiovascular functions and impulsive behavior. Population and family-based analyses of a minor allele (glutamine-to-stop substitution, designated Q20*) which blocks expression of this protein, and knockout studies in mice, suggest a role for this gene in impulsivity. However, other factors, such as elevated testosterone levels, may also be involved. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2016]

Uniprot Description

5-HT(2B): This is one of the several different receptors for 5- hydroxytryptamine (serotonin), a biogenic hormone that functions as a neurotransmitter, a hormone, and a mitogen. This receptor mediates its action by association with G proteins that activate a phosphatidylinositol-calcium second messenger system. Plays a role in the regulation of impulsive behavior. Belongs to the G-protein coupled receptor 1 family.

Protein type: GPCR, family 1; Receptor, GPCR; Membrane protein, integral; Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: 2q36.3-q37.1

Cellular Component: cytoplasm; plasma membrane

Molecular Function: drug binding; G-protein alpha-subunit binding; GTPase activator activity; serotonin binding; serotonin receptor activity

Biological Process: calcium-mediated signaling; cellular calcium ion homeostasis; cGMP biosynthetic process; embryonic morphogenesis; G-protein coupled receptor protein signaling pathway; heart morphogenesis; intestine smooth muscle contraction; negative regulation of apoptosis; negative regulation of autophagy; neural crest cell differentiation; neural crest cell migration; phosphoinositide 3-kinase cascade; phospholipase C activation; phosphorylation; positive regulation of cell division; positive regulation of cell proliferation; positive regulation of cytokine production; positive regulation of cytokine secretion; positive regulation of endothelial cell proliferation; positive regulation of I-kappaB kinase/NF-kappaB cascade; positive regulation of MAP kinase activity; positive regulation of nitric-oxide synthase activity; positive regulation of phosphatidylinositol biosynthetic process; protein kinase C activation; regulation of behavior; release of sequestered calcium ion into cytosol; response to drug; serotonin receptor signaling pathway; vasoconstriction

Research Articles on HTR2B

Similar Products

Product Notes

The HTR2B htr2b (Catalog #AAA1267295) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctctct cttacagagt gtctgaactt caaagcacaa ttcctgagca cattttgcag agcacctttg ttcacgttat ctcttctaac tggtctggat tacagacaga atcaatacca gaggaaatga aacagattgt tgaggaacag ggaaataaac tgcactgggc agctcttctg atactcatgg tgataatacc cacaattggt ggaaataccc ttgttattct ggctgtttca ctggagaaga agctgcagta tgctactaat tactttctaa tgtccttggc ggtggctgat ttgctggttg gattgtttgt gatgccaatt gccctcttga caataatgtt tgaggctatg tggcccctcc cacttgttct atgtcctgcc tggttatttc ttgacgttct cttttcaacc gcatccatca tgcatctctg tgccatttca gtggatcgtt acatagccat caaaaagcca atccaggcca atcaatataa ctcacgggct acagcattca tcaagattac agtggtgtgg ttaatttcaa taggcattgc cattccagtc cctattaaag ggatagagac tgatgtggac aacccaaaca atatcacttg tgtgctgaca aaggaacgtt ttggcgattt catgctcttt ggctcactgg ctgccttctt cacacctctt gcaattatga ttgtcaccta ctttctcact atccatgctt tacagaagaa ggcttactta gtcaaaaaca agccacctca acgcctaaca tggttgactg tgtctacagt tttccaaagg gatgaaacac cttgctcgtc accggaaaag gtggcaatgc tggatggttc tcgaaaggac aaggctctgc ccaactcagg tgatgaaaca cttatgcgaa gaacatccac aattgggaaa aagtcagtgc agaccatttc caacgaacag agagcctcaa aggtcctagg gattgtgttt ttcctctttt tgcttatgtg gtgtcccttc tttattacaa atataacttt agttttatgt gattcctgta accaaactac tctccaaatg ctcctggaga tatttgtgtg gataggctat gtttcctcag gagtgaatcc tttggtctac accctcttca ataagacatt tcgggatgca tttggccgat atatcacctg caattaccgg gccacaaagt cagtaaaaac tctcagaaaa cgctccagta agatctactt ccggaatcca atggcagaga actctaagtt tttcaagaaa catggaattc gaaatgggat taaccctgcc atgtaccaga gtccaatgag gctccgaagt tcaaccattc agtcttcatc aatcattcta ctagatacgc ttctcctcac tgaaaatgaa ggtgacaaaa ctgaagagcg agttagttat gtatag. It is sometimes possible for the material contained within the vial of "HTR2B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.