Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HSPD1 cdna clone

HSPD1 cDNA Clone

Gene Names
HSPD1; HLD4; CPN60; GROEL; HSP60; HSP65; SPG13; HSP-60; HuCHA60
Synonyms
HSPD1; HSPD1 cDNA Clone; HSPD1 cdna clone
Ordering
For Research Use Only!
Sequence
atgcttcggttacccacagtctttcgccagatgagaccggtgtccagggtactggctcctcatctcactcgggcttatgccaaagatgtaaaatttggtgcagatgcccgagccttaatgcttcaaggtgtagaccttttagccgatgctgtggccgttacaatggggccaaagggaagaacagtgattattgagcagagttggggaagtcccaaagtaacaaaagatggtgtgactgttgcaaagtcaattgacttaaaagataaatacaaaaacattggagctaaacttgttcaagatgttgccaataacacaaatgaagaagctggggatggcactaccactgctactgtactggcacgctctatagccaaggaaggcttcgagaagattagcaaaggtgctaatccagtggaaatcaggagaggtgtgatgttagctgttgatgctgtaattgctgaacttaaaaagcagtctaaacctgtgaccacccctgaagaaattgcacaggttgctacgatttctgcaaacggagacaaagaaattggcaatatcatctctgatgcaatgaaaaaagttggaagaaagggtgtcatcacagtaaaggatggaaaaacactgaatgatgaattagaaattattgaaggcatgaagtttgatcgaggctatatttctccatactttattaatacatcaaaaggtcagaaatgtgaattccaggatgcctatgttctgttgagtgaaaagaaaatttctagtatccagtccattgtacctgctcttgaaattgccaatgctcaccgtaagcctttggtcataatcgctgaagatgttgatggagaagctctaagtacactcgtcttgaataggctaaaggttggtcttcaggttgtggcagtcaaggctccagggtttggtgacaatagaaagaaccagcttaaagatatggctattgctactggtggtgcagtgtttggagaagagggattgaccctgaatcttgaagacgttcagcctcatgacttaggaaaagttggagaggtcattgtgaccaaagacgatgccatgctcttaaaaggaaaaggtgacaaggctcaaattgaaaaacgtattcaagaaatcattgagcagttagatgtcacaactagtgaatatgaaaaggaaaaactgaatgaacggcttgcaaaactttcagatggagtggctgtgctgaaggttggtgggacaagtgatgttgaagtgaatgaaaagaaagacagagttacagatgcccttaatgctacaagagctgctgttgaagaaggcattgttttgggagggggttgtgccctccttcgatgcattccagccttggactcattgactccagctaatgaagatcaaaaaattggtatagaaattattaaaagaacactcaaaattccagcaatgaccattgctaagaatgcaggtgttgaaggatctttgatagttgagaaaattatgcaaagttcctcagaagttggttatgatgctatggctggagattttgtgaatatggtggaaaaaggaatcattgacccaacaaaggttgtgagaactgctttattggatgctgctggtgtggcctctctgttaactacagcagaagttgtagtcacagaaattcctaaagaagagaaggaccctggaatgggtgcaatgggtggaatgggaggtggtatgggaggtggcatgttctaa
Sequence Length
1722
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
17,100 Da
NCBI Official Full Name
Homo sapiens heat shock 60kDa protein 1 (chaperonin), mRNA
NCBI Official Synonym Full Names
heat shock protein family D (Hsp60) member 1
NCBI Official Symbol
HSPD1
NCBI Official Synonym Symbols
HLD4; CPN60; GROEL; HSP60; HSP65; SPG13; HSP-60; HuCHA60
NCBI Protein Information
60 kDa heat shock protein, mitochondrial
UniProt Protein Name
60 kDa heat shock protein, mitochondrial
Protein Family
UniProt Gene Name
HSPD1
UniProt Synonym Gene Names
HSP60; CPN60; HSP-60; Hsp60
UniProt Entry Name
CH60_HUMAN

NCBI Description

This gene encodes a member of the chaperonin family. The encoded mitochondrial protein may function as a signaling molecule in the innate immune system. This protein is essential for the folding and assembly of newly imported proteins in the mitochondria. This gene is adjacent to a related family member and the region between the 2 genes functions as a bidirectional promoter. Several pseudogenes have been associated with this gene. Two transcript variants encoding the same protein have been identified for this gene. Mutations associated with this gene cause autosomal recessive spastic paraplegia 13. [provided by RefSeq, Jun 2010]

Uniprot Description

HSP60: Implicated in mitochondrial protein import and macromolecular assembly. May facilitate the correct folding of imported proteins. May also prevent misfolding and promote the refolding and proper assembly of unfolded polypeptides generated under stress conditions in the mitochondrial matrix. Interacts with HRAS. Interacts with HBV protein X and HTLV-1 protein p40tax. Belongs to the chaperonin (HSP60) family.

Protein type: Mitochondrial; Chaperone

Chromosomal Location of Human Ortholog: 2q33.1

Cellular Component: cell surface; coated pit; cyclin-dependent protein kinase activating kinase holoenzyme complex; cytoplasm; cytosol; early endosome; extracellular matrix; extracellular space; lipopolysaccharide receptor complex; membrane; mitochondrial inner membrane; mitochondrial matrix; mitochondrion; protein complex; secretory granule

Molecular Function: ATPase activity; chaperone binding; DNA replication origin binding; double-stranded RNA binding; lipopolysaccharide binding; p53 binding; protein binding; single-stranded DNA binding; ubiquitin protein ligase binding; unfolded protein binding

Biological Process: 'de novo' protein folding; B cell activation; B cell cytokine production; B cell proliferation; caspase activation; chaperone-mediated protein complex assembly; isotype switching to IgG isotypes; MyD88-dependent toll-like receptor signaling pathway; negative regulation of apoptosis; positive regulation of apoptosis; positive regulation of interferon-alpha production; positive regulation of interferon-gamma production; positive regulation of interleukin-10 production; positive regulation of interleukin-12 production; positive regulation of interleukin-6 production; positive regulation of macrophage activation; positive regulation of T cell activation; positive regulation of T cell mediated immune response to tumor cell; protein maturation; protein refolding; protein stabilization; response to cold; response to unfolded protein; T cell activation

Disease: Leukodystrophy, Hypomyelinating, 4; Spastic Paraplegia 13, Autosomal Dominant

Research Articles on HSPD1

Similar Products

Product Notes

The HSPD1 hspd1 (Catalog #AAA1276076) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcttcggt tacccacagt ctttcgccag atgagaccgg tgtccagggt actggctcct catctcactc gggcttatgc caaagatgta aaatttggtg cagatgcccg agccttaatg cttcaaggtg tagacctttt agccgatgct gtggccgtta caatggggcc aaagggaaga acagtgatta ttgagcagag ttggggaagt cccaaagtaa caaaagatgg tgtgactgtt gcaaagtcaa ttgacttaaa agataaatac aaaaacattg gagctaaact tgttcaagat gttgccaata acacaaatga agaagctggg gatggcacta ccactgctac tgtactggca cgctctatag ccaaggaagg cttcgagaag attagcaaag gtgctaatcc agtggaaatc aggagaggtg tgatgttagc tgttgatgct gtaattgctg aacttaaaaa gcagtctaaa cctgtgacca cccctgaaga aattgcacag gttgctacga tttctgcaaa cggagacaaa gaaattggca atatcatctc tgatgcaatg aaaaaagttg gaagaaaggg tgtcatcaca gtaaaggatg gaaaaacact gaatgatgaa ttagaaatta ttgaaggcat gaagtttgat cgaggctata tttctccata ctttattaat acatcaaaag gtcagaaatg tgaattccag gatgcctatg ttctgttgag tgaaaagaaa atttctagta tccagtccat tgtacctgct cttgaaattg ccaatgctca ccgtaagcct ttggtcataa tcgctgaaga tgttgatgga gaagctctaa gtacactcgt cttgaatagg ctaaaggttg gtcttcaggt tgtggcagtc aaggctccag ggtttggtga caatagaaag aaccagctta aagatatggc tattgctact ggtggtgcag tgtttggaga agagggattg accctgaatc ttgaagacgt tcagcctcat gacttaggaa aagttggaga ggtcattgtg accaaagacg atgccatgct cttaaaagga aaaggtgaca aggctcaaat tgaaaaacgt attcaagaaa tcattgagca gttagatgtc acaactagtg aatatgaaaa ggaaaaactg aatgaacggc ttgcaaaact ttcagatgga gtggctgtgc tgaaggttgg tgggacaagt gatgttgaag tgaatgaaaa gaaagacaga gttacagatg cccttaatgc tacaagagct gctgttgaag aaggcattgt tttgggaggg ggttgtgccc tccttcgatg cattccagcc ttggactcat tgactccagc taatgaagat caaaaaattg gtatagaaat tattaaaaga acactcaaaa ttccagcaat gaccattgct aagaatgcag gtgttgaagg atctttgata gttgagaaaa ttatgcaaag ttcctcagaa gttggttatg atgctatggc tggagatttt gtgaatatgg tggaaaaagg aatcattgac ccaacaaagg ttgtgagaac tgctttattg gatgctgctg gtgtggcctc tctgttaact acagcagaag ttgtagtcac agaaattcct aaagaagaga aggaccctgg aatgggtgca atgggtggaa tgggaggtgg tatgggaggt ggcatgttct aa. It is sometimes possible for the material contained within the vial of "HSPD1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.