HSPD1 cdna clone

HSPD1 cDNA Clone

Cat. Num. AAA1272539

• Gene Names: HSPD1; HLD4; CPN60; GROEL; HSP60; HSP65; SPG13; HSP-60; HuCHA60
• Synonyms: HSPD1; HSPD1 cDNA Clone; HSPD1 cdna clone

• Sequence: atgcttcggttacccacagtctttcggcagatgagaccggtgtccagggtactggctcctcatctcacccgggcttatgccaaagatgtaaaatttggtgcagatgcccgagccttaatgcttcaaggtgtagaccttttagccgatgctgtggccgttacaatggggccaaagggaagaacagtgattattgagcagagttggggaagtcccaaagtaacaaaagatggtgtgactgttgcaaagtcaattgacttaaaagataaatacaagaacattggagctaaacttgttcaagatgttgccaataacacaaatgaagaagctggggatggcactaccactgctactgtactggcacgctctatagccaaggaaggcttcgagaagattagcaaaggtgctaatccagtggaaatcaggagaggtgtgatgttagctgttgatgctgtaattgctgaacttaaaaagcagtctaaacctgtgaccacccctgaagaaattgcacaggttgctacgatttctgcaaacggagacaaagaaattggcaatatcatctctgatgcaatgaaaaaagttggaagaaagggtgtcatcacagtaaaggatggaaaaacactgaatgatgaattagaaattattgaaggcatgaagtttgatcgaggctatatttctccatactttattaatacatcaaaaggtcagaaatgtgaattccaggatgcctatgttctgttgagtgaaaagaaaatttctagtatccagtccattgtacctgctcttgaaattgccaatgctcaccgtaagcctttggtcataatcgctgaagatgttgatggagaagctctaagtacactcgtcttgaataggctaaaggttggtcttcaggttgtggcagtcaaggctccagggtttggtgacaatagaaagaaccagcttaaagatatggctattgctactggtggtgcagtgtttggagaagagggattgaccctgaatcttgaagacgttcagcctcatgacttaggaaaagttggagaggtcattgtgaccaaagacgatgccatgctcttaaaaggaaaaggtgacaaggctcaaattgaaaaacgtattcaagaaatcattgagcagttagatgtcacaactagtgaatatgaaaaggaaaaactgaatgaacggcttgcaaaactttcagatggagtggctgtgctgaaggttggtgggacaagtgatgttgaagtgaatgaaaagaaagacagagttacagatgcccttaatgctacaagagctgctgttgaagaaggcattgttttgggagggggttgtgccctccttcgatgcattccagccttggactcattgactccagctaatgaagatcaaaaaattggtatagaaattattaaaagaacactcaaaattccagcaatgaccattgctaagaatgcaggtgttgaaggatctttgatagttgagaaaattatgcaaagttcctcagaagttggttatgatgctatggctggagattttgtgaatatggtggaaaaaggaatcattgacccaacaaaggttgtgagaactgctttattggatgctgctggtgtggcctctctgttaactacagcagaagttgtagtcacagaaattcctaaagaagagaaggaccctggaatgggtgcaatgggtggaatgggaggtggtatgggaggtggcatgttctaa
• Sequence Length: 1722

• Vector: pENTR223.1 or pUC
• Clone Sequence Report: Provided with product shipment

NCBI and Uniprot Product Information

• NCBI GI #: 12804340
• NCBI GeneID: 3329
• Molecular Weight: 17,100 Da
• NCBI Official Full Name: Homo sapiens heat shock 60kDa protein 1 (chaperonin), mRNA
• NCBI Official Synonym Full Names: heat shock protein family D (Hsp60) member 1
• NCBI Official Symbol: HSPD1
• NCBI Official Synonym Symbols: HLD4; CPN60; GROEL; HSP60; HSP65; SPG13; HSP-60; HuCHA60
• NCBI Protein Information: 60 kDa heat shock protein, mitochondrial
• UniProt Protein Name: 60 kDa heat shock protein, mitochondrial
• Protein Family: 60 kDa heat shock protein
• UniProt Gene Name: HSPD1
• UniProt Synonym Gene Names: HSP60; CPN60; HSP-60; Hsp60
• UniProt Entry Name: CH60_HUMAN

NCBI Description

This gene encodes a member of the chaperonin family. The encoded mitochondrial protein may function as a signaling molecule in the innate immune system. This protein is essential for the folding and assembly of newly imported proteins in the mitochondria. This gene is adjacent to a related family member and the region between the 2 genes functions as a bidirectional promoter. Several pseudogenes have been associated with this gene. Two transcript variants encoding the same protein have been identified for this gene. Mutations associated with this gene cause autosomal recessive spastic paraplegia 13. [provided by RefSeq, Jun 2010]

Uniprot Description

HSP60: Implicated in mitochondrial protein import and macromolecular assembly. May facilitate the correct folding of imported proteins. May also prevent misfolding and promote the refolding and proper assembly of unfolded polypeptides generated under stress conditions in the mitochondrial matrix. Interacts with HRAS. Interacts with HBV protein X and HTLV-1 protein p40tax. Belongs to the chaperonin (HSP60) family.

Protein type: Chaperone; Mitochondrial

Chromosomal Location of Human Ortholog: 2q33.1

Cellular Component: cell surface; coated pit; cyclin-dependent protein kinase activating kinase holoenzyme complex; cytoplasm; cytosol; early endosome; extracellular matrix; extracellular space; lipopolysaccharide receptor complex; membrane; mitochondrial inner membrane; mitochondrial matrix; mitochondrion; protein complex; secretory granule

Molecular Function: ATPase activity; chaperone binding; DNA replication origin binding; double-stranded RNA binding; lipopolysaccharide binding; p53 binding; protein binding; single-stranded DNA binding; ubiquitin protein ligase binding; unfolded protein binding

Biological Process: 'de novo' protein folding; B cell activation; B cell cytokine production; B cell proliferation; caspase activation; chaperone-mediated protein complex assembly; isotype switching to IgG isotypes; MyD88-dependent toll-like receptor signaling pathway; negative regulation of apoptosis; positive regulation of apoptosis; positive regulation of interferon-alpha production; positive regulation of interferon-gamma production; positive regulation of interleukin-10 production; positive regulation of interleukin-12 production; positive regulation of interleukin-6 production; positive regulation of macrophage activation; positive regulation of T cell activation; positive regulation of T cell mediated immune response to tumor cell; protein maturation; protein refolding; protein stabilization; response to cold; response to unfolded protein; T cell activation

Disease: Leukodystrophy, Hypomyelinating, 4; Spastic Paraplegia 13, Autosomal Dominant