Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HSPB7 cdna clone

HSPB7 cDNA Clone

Gene Names
HSPB7; cvHSP
Synonyms
HSPB7; HSPB7 cDNA Clone; HSPB7 cdna clone
Ordering
For Research Use Only!
Sequence
atgagccacagaacctcttccaccttccgagcggagagaagtttccattcctcttcttcttcctcctcctcttccacctcctcctcggcctcccgtgccctcccggcccaggacccgcccatggagaaggccctgagcatgttttccgatgactttggcagcttcatgcggccccactcggagcccctggccttcccagcccgccccggtggggcaggcaacatcaagaccctaggagacgcctatgagtttgcggtggacgtgagagacttctcacctgaagacatcattgtcaccacctccaacaaccacatcgaggtgcgggctgagaagctggcggctgacggcaccgtcatgaacaccttcgctcacaagtgccagctgccggaggacgtggacccgacgtcggtgacctcggctctgcgggaggacggcagcctcactatccgggcacggcgtcacccgcatacagaacacgtccagcagaccttccggacggagatcaaaatctga
Sequence Length
513
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
7,344 Da
NCBI Official Full Name
Homo sapiens heat shock 27kDa protein family, member 7 (cardiovascular), mRNA
NCBI Official Synonym Full Names
heat shock protein family B (small) member 7
NCBI Official Symbol
HSPB7
NCBI Official Synonym Symbols
cvHSP
NCBI Protein Information
heat shock protein beta-7
UniProt Protein Name
Heat shock protein beta-7
Protein Family
UniProt Gene Name
HSPB7
UniProt Synonym Gene Names
CVHSP; HspB7; cvHsp
UniProt Entry Name
HSPB7_HUMAN

Uniprot Description

HSPB7: Belongs to the small heat shock protein (HSP20) family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Heat shock protein

Chromosomal Location of Human Ortholog: 1p36.13

Cellular Component: cytoplasm; nucleoplasm; nucleus

Molecular Function: protein binding; protein C-terminus binding

Biological Process: regulation of heart contraction; response to unfolded protein

Research Articles on HSPB7

Similar Products

Product Notes

The HSPB7 hspb7 (Catalog #AAA1266057) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagccaca gaacctcttc caccttccga gcggagagaa gtttccattc ctcttcttct tcctcctcct cttccacctc ctcctcggcc tcccgtgccc tcccggccca ggacccgccc atggagaagg ccctgagcat gttttccgat gactttggca gcttcatgcg gccccactcg gagcccctgg ccttcccagc ccgccccggt ggggcaggca acatcaagac cctaggagac gcctatgagt ttgcggtgga cgtgagagac ttctcacctg aagacatcat tgtcaccacc tccaacaacc acatcgaggt gcgggctgag aagctggcgg ctgacggcac cgtcatgaac accttcgctc acaagtgcca gctgccggag gacgtggacc cgacgtcggt gacctcggct ctgcgggagg acggcagcct cactatccgg gcacggcgtc acccgcatac agaacacgtc cagcagacct tccggacgga gatcaaaatc tga. It is sometimes possible for the material contained within the vial of "HSPB7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.