Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HSPA14 cdna clone

HSPA14 cDNA Clone

Gene Names
HSPA14; HSP70-4; HSP70L1
Synonyms
HSPA14; HSPA14 cDNA Clone; HSPA14 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggccatcggagttcacctgggctgcacctcagcctgtgtggccgtctataaggatggccgggctggtgtggttgcaaatgatgccggtgaccgagttactccagctgttgttgcttactcagaaaatgaagagattgttggattggcagcaaaacaaagtagaataagaaatatttcaaatacagtaatgaaagtaaagcagatcctgggcagaagccagaaatgcggtccttggacctggcttctcagcaattatccctga
Sequence Length
267
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
54,794 Da
NCBI Official Full Name
Homo sapiens heat shock 70kDa protein 14, mRNA
NCBI Official Synonym Full Names
heat shock protein family A (Hsp70) member 14
NCBI Official Symbol
HSPA14
NCBI Official Synonym Symbols
HSP70-4; HSP70L1
NCBI Protein Information
heat shock 70 kDa protein 14
UniProt Protein Name
Heat shock 70 kDa protein 14
Protein Family
UniProt Gene Name
HSPA14
UniProt Synonym Gene Names
HSP60; HSP70L1
UniProt Entry Name
HSP7E_HUMAN

Uniprot Description

HSPA14: Component of the ribosome-associated complex (RAC), a complex involved in folding or maintaining nascent polypeptides in a folding-competent state. In the RAC complex, binds to the nascent polypeptide chain, while DNAJC2 stimulates its ATPase activity. Belongs to the heat shock protein 70 family.

Protein type: Heat shock protein

Chromosomal Location of Human Ortholog: 10p13

Cellular Component: cytosol; membrane; ribosome

Molecular Function: protein binding

Biological Process: 'de novo' cotranslational protein folding

Research Articles on HSPA14

Similar Products

Product Notes

The HSPA14 hspa14 (Catalog #AAA1270218) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcca tcggagttca cctgggctgc acctcagcct gtgtggccgt ctataaggat ggccgggctg gtgtggttgc aaatgatgcc ggtgaccgag ttactccagc tgttgttgct tactcagaaa atgaagagat tgttggattg gcagcaaaac aaagtagaat aagaaatatt tcaaatacag taatgaaagt aaagcagatc ctgggcagaa gccagaaatg cggtccttgg acctggcttc tcagcaatta tccctga. It is sometimes possible for the material contained within the vial of "HSPA14, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.