Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HPS5 cdna clone

HPS5 cDNA Clone

Gene Names
HPS5; AIBP63; BLOC2S2
Synonyms
HPS5; HPS5 cDNA Clone; HPS5 cdna clone
Ordering
For Research Use Only!
Sequence
atgtatgtgtcttcagaacacaaaggccgaagagtcacagctctctgctgggatacagctattcttagagtttttgtaggtgatcatgctgggaaggtttctgctatcaaactcaatacttctaaacaagcaaaggcagctgctgcttttgtgatgtttcctgttcagacaatcacaactgttgactcctgtgttgtacagttagattatttggatggaaggctacttatatcttcacttactcgatccttcttgtgtgacactgagagagaaaagttttggaaaattggaaacaaggaaagagatggagaatatggagcttgtttctttcctggaagatgttctgggggccagcaacctctgatatattgtgctcgcccaggctctaggatgtgggaagtgaactttgatggagaagttataagtacacatcagttcaagaaactcctctcgttgccacctctccctgtgattactctaagatcagaacctcagtatgatcatacagctggatcctcccagtctttgtctttccccaaactcttacatcttagtgagcattgtgtgctgacttggacagaaagaggaatttatattttcattcctcagaatgttcaagttcttctttggagtgaagtcaaagatattcaggatgtggctgtctgtaggaatgaattgttctgtttgcacctaaatgggaaagtctcacatctctccctgatatctgtggagcgctgtgtggaacgcctgctaagaagaggcctatggaacttggctgctcgtacatgctgtcttttccaaaattctgtcattgccagcagagcaagaaaaactttgactgcagataaattggagcatttgaaatctcagctggaccatggcacctacaatgatctaatttctcaactggaagaattgatcttaaaatttgaacctttggattcagcttgtagcagtagaagaagctccatttcatcacatgaaagtttcagcatcttggactctggtatttatcgtatcattagtagtagaagaggcagtcagtcagatgaagactcttgctcccttcacagccaaaccctctcagaagatgagagatttaaagaattcacctcacagcaggaagaggacctgccagatcagtgttgtggctcacacggaaatgaagacaatgtttctcatgctccagtgatgtttgagacagataagaatgaaacttttctcccgttcggcattccattaccatttcgttctccatctcctcttgtgtctcttcaggctgtcaaagaaagtgtttctagctttgtgcgtaaaactactgagaagattggcacccttcacacgagccctgatctgaaagtgagaccagagctcaggggtgatgagcaatcatgtgaagaggatgtgagttcagatacctgcccaaaggaggaagacactgaggaggaaaaagaggtaactagtccacctccagaagaagacaggttccaggagcttaaagtagcaacagcagaagcaatgaccaagctacaggaccctctggttttatttgaatccgagtctctgagaatggttttacaggagtggctttcacatttagaaaaaacatttgccatgaaggacttttcaggtgtttcagatactgacaactcatccatgaaattgaaccaggatgtgctattagttaatgaatcaaaaaagggaatattagatgaagataatgaaaaagaaaaaagggactctttaggcaatgaagaatctgttgataaaacagcatgtgaatgtgtaaggagtccaagggagtctttggatgacctgtttcaaatatgttctccatgcgccattgcaagtggtcttcggaacgacctggctgaattgacaacattatgtttggagttgaatgtattgaattctaagatcaaaagcaccagtggacatgtggaccacactttgcaacagtactctcctgaaattctggcttgccagttcctgaagaagtacttttttctcctgaacttgaaaagagcgaaggagagtatcaagcttagttacagtaatagcccttctgtttgggatacttttattgaaggattgaaagaaatggcaagttccaatcctgtgtatatggagatggaaaaaggagatctaccaacaaggttaaagttactagatgacgaggttccttttgatagtccgttgttggttgtttatgctacccggttgtatgaaaagtttggggagtctgctcttcgatccttaatcaagttctttccatccattttgccatcggatatcatacaactttgtcatcatcatcctgctgagtttttggcctatttagacagtctggtgaaatcaaggcctgaagatcagcggtcatcttttcttgagtcccttctgcaaccagagtctttaaggttggattggctgcttttggcagtgtcccttgatgctccaccaagcaccagcacaatggatgatgaaggttatcccaggcctcattcacacttgctttcctggggttacagtcagctgatccttcatctaattaaacttcctgcagattttataaccaaagagaaaatgacagacatctgcaggtcttgtggtttctggcctggatatctaattctctgtttggagctggagagaagaagagaggccttcaccaatattgtgtatctgaatgatatgagcctgatgaaaggggacaatggttggatcccagagaccgtggaggaatggaagcttctccttcatctcatacagagcaagagcacgaggccagccccccaggagtcactaaatgggagcctcagtgatgggccttcccccatcaatgtggagaatgtggcacttctgttagctaaggccatgggcccagatcgggcttggtcactgctacaggaatgtggtctggcccttgagttgtcagagaagtttaccagaacctgcgatatcctgaggattgctgagaaaaggcagagggccttgatacaaagcatgcttgaaaaatgcgatcggtttctctggtcccagcaggcctag
Sequence Length
3048
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
114,826 Da
NCBI Official Full Name
Homo sapiens Hermansky-Pudlak syndrome 5, mRNA
NCBI Official Synonym Full Names
HPS5, biogenesis of lysosomal organelles complex 2 subunit 2
NCBI Official Symbol
HPS5
NCBI Official Synonym Symbols
AIBP63; BLOC2S2
NCBI Protein Information
Hermansky-Pudlak syndrome 5 protein
UniProt Protein Name
Hermansky-Pudlak syndrome 5 protein
UniProt Gene Name
HPS5
UniProt Synonym Gene Names
AIBP63; KIAA1017; Ru2
UniProt Entry Name
HPS5_HUMAN

NCBI Description

This gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. This protein interacts with Hermansky-Pudlak syndrome 6 protein and may interact with the cytoplasmic domain of integrin, alpha-3. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 5. Multiple transcript variants encoding two distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

HPS5: May regulate the synthesis and function of lysosomes and of highly specialized organelles, such as melanosomes and platelet dense granules. Regulates intracellular vesicular trafficking in fibroblasts. May be involved in the regulation of general functions of integrins. Defects in HPS5 are the cause of Hermansky-Pudlak syndrome type 5 (HPS5). Hermansky-Pudlak syndrome (HPS) is a genetically heterogeneous, rare, autosomal recessive disorder characterized by oculocutaneous albinism, bleeding due to platelet storage pool deficiency, and lysosomal storage defects. This syndrome results from defects of diverse cytoplasmic organelles including melanosomes, platelet dense granules and lysosomes. Ceroid storage in the lungs is associated with pulmonary fibrosis, a common cause of premature death in individuals with HPS. Belongs to the HPS5 family. 2 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 11p14

Disease: Hermansky-pudlak Syndrome 5

Research Articles on HPS5

Similar Products

Product Notes

The HPS5 hps5 (Catalog #AAA1278988) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtatgtgt cttcagaaca caaaggccga agagtcacag ctctctgctg ggatacagct attcttagag tttttgtagg tgatcatgct gggaaggttt ctgctatcaa actcaatact tctaaacaag caaaggcagc tgctgctttt gtgatgtttc ctgttcagac aatcacaact gttgactcct gtgttgtaca gttagattat ttggatggaa ggctacttat atcttcactt actcgatcct tcttgtgtga cactgagaga gaaaagtttt ggaaaattgg aaacaaggaa agagatggag aatatggagc ttgtttcttt cctggaagat gttctggggg ccagcaacct ctgatatatt gtgctcgccc aggctctagg atgtgggaag tgaactttga tggagaagtt ataagtacac atcagttcaa gaaactcctc tcgttgccac ctctccctgt gattactcta agatcagaac ctcagtatga tcatacagct ggatcctccc agtctttgtc tttccccaaa ctcttacatc ttagtgagca ttgtgtgctg acttggacag aaagaggaat ttatattttc attcctcaga atgttcaagt tcttctttgg agtgaagtca aagatattca ggatgtggct gtctgtagga atgaattgtt ctgtttgcac ctaaatggga aagtctcaca tctctccctg atatctgtgg agcgctgtgt ggaacgcctg ctaagaagag gcctatggaa cttggctgct cgtacatgct gtcttttcca aaattctgtc attgccagca gagcaagaaa aactttgact gcagataaat tggagcattt gaaatctcag ctggaccatg gcacctacaa tgatctaatt tctcaactgg aagaattgat cttaaaattt gaacctttgg attcagcttg tagcagtaga agaagctcca tttcatcaca tgaaagtttc agcatcttgg actctggtat ttatcgtatc attagtagta gaagaggcag tcagtcagat gaagactctt gctcccttca cagccaaacc ctctcagaag atgagagatt taaagaattc acctcacagc aggaagagga cctgccagat cagtgttgtg gctcacacgg aaatgaagac aatgtttctc atgctccagt gatgtttgag acagataaga atgaaacttt tctcccgttc ggcattccat taccatttcg ttctccatct cctcttgtgt ctcttcaggc tgtcaaagaa agtgtttcta gctttgtgcg taaaactact gagaagattg gcacccttca cacgagccct gatctgaaag tgagaccaga gctcaggggt gatgagcaat catgtgaaga ggatgtgagt tcagatacct gcccaaagga ggaagacact gaggaggaaa aagaggtaac tagtccacct ccagaagaag acaggttcca ggagcttaaa gtagcaacag cagaagcaat gaccaagcta caggaccctc tggttttatt tgaatccgag tctctgagaa tggttttaca ggagtggctt tcacatttag aaaaaacatt tgccatgaag gacttttcag gtgtttcaga tactgacaac tcatccatga aattgaacca ggatgtgcta ttagttaatg aatcaaaaaa gggaatatta gatgaagata atgaaaaaga aaaaagggac tctttaggca atgaagaatc tgttgataaa acagcatgtg aatgtgtaag gagtccaagg gagtctttgg atgacctgtt tcaaatatgt tctccatgcg ccattgcaag tggtcttcgg aacgacctgg ctgaattgac aacattatgt ttggagttga atgtattgaa ttctaagatc aaaagcacca gtggacatgt ggaccacact ttgcaacagt actctcctga aattctggct tgccagttcc tgaagaagta cttttttctc ctgaacttga aaagagcgaa ggagagtatc aagcttagtt acagtaatag cccttctgtt tgggatactt ttattgaagg attgaaagaa atggcaagtt ccaatcctgt gtatatggag atggaaaaag gagatctacc aacaaggtta aagttactag atgacgaggt tccttttgat agtccgttgt tggttgttta tgctacccgg ttgtatgaaa agtttgggga gtctgctctt cgatccttaa tcaagttctt tccatccatt ttgccatcgg atatcataca actttgtcat catcatcctg ctgagttttt ggcctattta gacagtctgg tgaaatcaag gcctgaagat cagcggtcat cttttcttga gtcccttctg caaccagagt ctttaaggtt ggattggctg cttttggcag tgtcccttga tgctccacca agcaccagca caatggatga tgaaggttat cccaggcctc attcacactt gctttcctgg ggttacagtc agctgatcct tcatctaatt aaacttcctg cagattttat aaccaaagag aaaatgacag acatctgcag gtcttgtggt ttctggcctg gatatctaat tctctgtttg gagctggaga gaagaagaga ggccttcacc aatattgtgt atctgaatga tatgagcctg atgaaagggg acaatggttg gatcccagag accgtggagg aatggaagct tctccttcat ctcatacaga gcaagagcac gaggccagcc ccccaggagt cactaaatgg gagcctcagt gatgggcctt cccccatcaa tgtggagaat gtggcacttc tgttagctaa ggccatgggc ccagatcggg cttggtcact gctacaggaa tgtggtctgg cccttgagtt gtcagagaag tttaccagaa cctgcgatat cctgaggatt gctgagaaaa ggcagagggc cttgatacaa agcatgcttg aaaaatgcga tcggtttctc tggtcccagc aggcctag. It is sometimes possible for the material contained within the vial of "HPS5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.