Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HOOK1 cdna clone

HOOK1 cDNA Clone

Gene Names
HOOK1; HK1
Synonyms
HOOK1; HOOK1 cDNA Clone; HOOK1 cdna clone
Ordering
For Research Use Only!
Sequence
atggaggagacgcagccgccgccgcagcctaagctgcccctgtgcgacagcctcatgatctggctgcagacattcaatactgcctcaccttgtcaagatgtcaaacagctgactagtggagttgccatggcacaagttcttcatcaaattgatgcagcttggtttaacgaatcttggttaagccgaattaaagaggatgttggggacaactggagaataaaggccagtaatgtaaagaaggtccttcaaggaattatgagttattatcatgagtttttggggcagcagatttcagaagcacttatccctgatttaaaccaaataaccgaatgttcagatccagtggagcttgggaggttgctccagcttattttaggttgtgcgatcaactgtgaaaagaagcaagaacatattcaaaatataatgacactggaagagtctgttcaacatgtggtcatgactgctattcaagagttgatgagtaaagaaatattgagctctcctccaaatgatgctgttggagaattggagcaacagcttaaaagagccttggaagaacttcaggaagcactagcagaaaaagaagagctgaggcaaagatgtgaagaattggatatgcaggtgactacacttcaagatgaaaagaattcactggtttctgaaaatgagatgatgaatgaaaaacttgaccagttggatggctcttttgatgatccaaacacagtggttgcaaaaaagtattttcatgcacaattacaactagaacaattacaggaagaaaacttcaggcttgaagctgcaaaagatgattaccgtgttcactgtgaagaacttgaaaagcagctaatcgaattccagcataggaatgatgaattgactagtcttgcagaagaaacaagagccctgaaagatgaaatagatgttcttagggctacctctgataaagcaaataaactggagtcaacagttgagatatatcgtcagaagctacaagatctgaatgaccttcgcaagcaggtgaaaactttacaggaaaccaacatgatgtatatgcataatacagtcagcttagaagaagaattaaaaaaagcaaatgcagcacgtacacaattagaaacatacaaaaggcaggttcaagatcttcatgttaaactttcctccgaatccaagagggcagacacactagcgtttgaaatgaagcggcttgaagaaaaacatgaagctttacttaaggaaaaagagagactaattgagcagcgtgatactttgaaagaaacaaatgaagagcttcgatgttcacaagtacaacaggaccacctaaaccaaacagatgcatctgctacaaaaagttatgagaatcttgctgctgagattatgccagtggaatatagggaggtgtttattcgactgcaacatgaaaataagatgcttcgcttacagcaagaaggctctgagaatgaacgtattgaggaacttcaggagcagctagaacagaaacaccgtaaaatgaatgaactggaaactgagcagaggctgagcaaagagcgtattagagaattgcagcagcagattgaggacctccagaaatctttacaggaacaaggttccaagtctgaaggcgaaagttccagcaaattaaagcagaagttggaagctcatatggaaaaactcacagaggtccatgaagaattacagaagaaacaagaactcattgaagatcttcagccagatataaatcaaaatgtacaaaagatcaatgaacttgaagctgctcttcagaagaaagatgaagatatgaaagcaatggaggaaagatataaaatgtacttggagaaagccagaaatgtaataaaaactttggatcccaagttaaatccagcatcagctgaaataatgctactaagaaagcagttggcagagaaagagagaagaattgagattctggagagtgaatgcaaagtagcaaaattccgtgattatgaagaaaaactcattgtttctgcgtggtataataagagtctagcattccagaaactggggatggaatctagacttgtgagcggcggtggtgcctgcagtgacactggtgcgtgcactcctgcgcggtctttcttagcgcagcaacggcacatcaccaacaccagaagaaatctctctgttaaagtccctgctacaacatctgattaa
Sequence Length
2187
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
80,021 Da
NCBI Official Full Name
Homo sapiens hook homolog 1 (Drosophila), mRNA
NCBI Official Synonym Full Names
hook microtubule tethering protein 1
NCBI Official Symbol
HOOK1
NCBI Official Synonym Symbols
HK1
NCBI Protein Information
protein Hook homolog 1
UniProt Protein Name
Protein Hook homolog 1
Protein Family
UniProt Gene Name
HOOK1
UniProt Synonym Gene Names
h-hook1; hHK1
UniProt Entry Name
HOOK1_HUMAN

NCBI Description

This gene encodes a member of the hook family of coiled-coil proteins, which bind to microtubules and organelles through their N- and C-terminal domains, respectively. The encoded protein localizes to discrete punctuate subcellular structures, and interacts with several members of the Rab GTPase family involved in endocytosis. It is thought to link endocytic membrane trafficking to the microtubule cytoskeleton. Several alternatively spliced transcript variants have been identified, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]

Uniprot Description

HOOK1: Required for spermatid differentiation. Probably involved in the positioning of the microtubules of the manchette and the flagellum in relation to the membrane skeleton. Component of the FTS/Hook/FHIP complex (FHF complex). The FHF complex may function to promote vesicle trafficking and/or fusion via the homotypic vesicular protein sorting complex (the HOPS complex). Belongs to the hook family.

Protein type: Cytoskeletal

Chromosomal Location of Human Ortholog: 1p32.1

Molecular Function: identical protein binding; protein binding

Biological Process: early endosome to late endosome transport; endosome organization and biogenesis; endosome to lysosome transport; lysosome organization and biogenesis

Research Articles on HOOK1

Similar Products

Product Notes

The HOOK1 hook1 (Catalog #AAA1267375) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaggaga cgcagccgcc gccgcagcct aagctgcccc tgtgcgacag cctcatgatc tggctgcaga cattcaatac tgcctcacct tgtcaagatg tcaaacagct gactagtgga gttgccatgg cacaagttct tcatcaaatt gatgcagctt ggtttaacga atcttggtta agccgaatta aagaggatgt tggggacaac tggagaataa aggccagtaa tgtaaagaag gtccttcaag gaattatgag ttattatcat gagtttttgg ggcagcagat ttcagaagca cttatccctg atttaaacca aataaccgaa tgttcagatc cagtggagct tgggaggttg ctccagctta ttttaggttg tgcgatcaac tgtgaaaaga agcaagaaca tattcaaaat ataatgacac tggaagagtc tgttcaacat gtggtcatga ctgctattca agagttgatg agtaaagaaa tattgagctc tcctccaaat gatgctgttg gagaattgga gcaacagctt aaaagagcct tggaagaact tcaggaagca ctagcagaaa aagaagagct gaggcaaaga tgtgaagaat tggatatgca ggtgactaca cttcaagatg aaaagaattc actggtttct gaaaatgaga tgatgaatga aaaacttgac cagttggatg gctcttttga tgatccaaac acagtggttg caaaaaagta ttttcatgca caattacaac tagaacaatt acaggaagaa aacttcaggc ttgaagctgc aaaagatgat taccgtgttc actgtgaaga acttgaaaag cagctaatcg aattccagca taggaatgat gaattgacta gtcttgcaga agaaacaaga gccctgaaag atgaaataga tgttcttagg gctacctctg ataaagcaaa taaactggag tcaacagttg agatatatcg tcagaagcta caagatctga atgaccttcg caagcaggtg aaaactttac aggaaaccaa catgatgtat atgcataata cagtcagctt agaagaagaa ttaaaaaaag caaatgcagc acgtacacaa ttagaaacat acaaaaggca ggttcaagat cttcatgtta aactttcctc cgaatccaag agggcagaca cactagcgtt tgaaatgaag cggcttgaag aaaaacatga agctttactt aaggaaaaag agagactaat tgagcagcgt gatactttga aagaaacaaa tgaagagctt cgatgttcac aagtacaaca ggaccaccta aaccaaacag atgcatctgc tacaaaaagt tatgagaatc ttgctgctga gattatgcca gtggaatata gggaggtgtt tattcgactg caacatgaaa ataagatgct tcgcttacag caagaaggct ctgagaatga acgtattgag gaacttcagg agcagctaga acagaaacac cgtaaaatga atgaactgga aactgagcag aggctgagca aagagcgtat tagagaattg cagcagcaga ttgaggacct ccagaaatct ttacaggaac aaggttccaa gtctgaaggc gaaagttcca gcaaattaaa gcagaagttg gaagctcata tggaaaaact cacagaggtc catgaagaat tacagaagaa acaagaactc attgaagatc ttcagccaga tataaatcaa aatgtacaaa agatcaatga acttgaagct gctcttcaga agaaagatga agatatgaaa gcaatggagg aaagatataa aatgtacttg gagaaagcca gaaatgtaat aaaaactttg gatcccaagt taaatccagc atcagctgaa ataatgctac taagaaagca gttggcagag aaagagagaa gaattgagat tctggagagt gaatgcaaag tagcaaaatt ccgtgattat gaagaaaaac tcattgtttc tgcgtggtat aataagagtc tagcattcca gaaactgggg atggaatcta gacttgtgag cggcggtggt gcctgcagtg acactggtgc gtgcactcct gcgcggtctt tcttagcgca gcaacggcac atcaccaaca ccagaagaaa tctctctgtt aaagtccctg ctacaacatc tgattaa. It is sometimes possible for the material contained within the vial of "HOOK1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.