Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HNRNPM cdna clone

HNRNPM cDNA Clone

Gene Names
HNRNPM; CEAR; HNRPM; HTGR1; NAGR1; HNRPM4; HNRNPM4; hnRNP M
Synonyms
HNRNPM; HNRNPM cDNA Clone; HNRNPM cdna clone
Ordering
For Research Use Only!
Sequence
atggcggcaggggtcgaagcggcggcggaggtggcggcgacggagatcaaaatggaggaagagagcggcgcgcccggcgtgccgagcggcaacggggctccgggccctaagggtgaaggagaacgacctgctcagaatgagaagaggaaggagaaaaacataaaaagaggaggcaatcgctttgagccatatgccaatccaactaaaagatacagagccttcattacaaacataccttttgatgtgaaatggcagtcacttaaagacctggttaaagaaaaagttggtgaggtaacatacgtggagctcttaatggacgctgaaggaaagtcaaggggatgtgctgttgttgaattcaagatggaagagagcatgaaaaaagctgcggaagtcctaaacaagcatagtctgagcggaagaccactgaaagtcaaagaagatcctgatggtgaacatgccaggagagcaatgcaaaaggtgatggctacgactggtgggatgggtatgggaccaggtggcccaggaatgattactatcccacccagtatcctaaataatcccaacatcccaaatgagattatccatgcattacaggctggaagacttggaagcacagtatttgtagcaaatctggattataaagttggctggaagaaactgaaggaagtatttagtatggctggtgtggtggtccgagcagacattcttgaagataaagatggaaaaagtcgtggaataggcactgttacttttgaacagtccattgaagctgtgcaagctatatctatgttcaatggccagctgctatttgatagaccaatgcacgtcaagatggatgagagggccttaccaaaaggagatttcttccctcctgagcgtccacaacaacttccccatggccttggtggtattggcatggggttaggaccaggagggcaacccattgatgccaatcacctgaataaaggcatcggaatgggaaacataggtcccgcaggaatgggaatggaaggcataggatttggaataaataaaatgggaggaatggaggggccctttggtggtggtatggaaaacatgggtcgatttggatctgggatgaacatgggcaggataaatgaaatcctaagtaatgcactgaagagaggagagatcattgcaaagcagggaggaggtggaggtggaggaagcgtccctgggatcgagaggatgggtcctggcattgaccgcctcgggggtgccggcatggagcgcatgggcgcgggcctgggccacggcatggatcgcgtgggctccgagatcgagcgcatgggcctggtcatggaccgcatgggctccgtggagcgcatgggctccggcattgagcgcatgggcccgctgggcctcgaccacatggcctccagcattgagcgcatgggccagaccatggagcgcattggctctggcgtggagcgcatgggtgccggcatgggcttcggccttgagcgcatggccgctcccatcgaccgtgtgggccagaccattgagcgcatgggctctggcgtggagcgcatgggccctgccatcgagcgcatgggcctgagcatggagcgcatggtgcccgcaggtatgggagctggcctggagcgcatgggccccgtgatggatcgcatggccaccggcctggagcgcatgggcgccaacaatctggagcggatgggcctggagcgcatgggcgccaacagcctcgagcgcatgggcctggagcgcatgggtgccaacagcctcgagcgcatgggccccgccatgggcccggccctgggcgctggcattgagcgcatgggcctggccatgggtggcggtggcggtgccagctttgaccgtgccatcgagatggagcgtggcaacttcggaggaagcttcgcaggttcctttggtggagctggaggccatgctcctggggtggccaggaaggcctgccagatatttgtgagaaatctgccattcgatttcacatggaagatgctaaaggacaaattcaacgagtgcggccacgtgctgtacgccgacatcaagatggagaatgggaagtccaaggggtgtggtgtggttaagttcgagtcgccagaggtggccgagagagcctgccggatgatgaatggcatgaagctgagtggccgagagattgacgttcgaattgatagaaacgcttaa
Sequence Length
2193
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
– Da
NCBI Official Full Name
Homo sapiens heterogeneous nuclear ribonucleoprotein M, mRNA
NCBI Official Synonym Full Names
heterogeneous nuclear ribonucleoprotein M
NCBI Official Symbol
HNRNPM
NCBI Official Synonym Symbols
CEAR; HNRPM; HTGR1; NAGR1; HNRPM4; HNRNPM4; hnRNP M
NCBI Protein Information
heterogeneous nuclear ribonucleoprotein M
UniProt Protein Name
Heterogeneous nuclear ribonucleoprotein M
UniProt Gene Name
HNRNPM
UniProt Synonym Gene Names
HNRPM; NAGR1; hnRNP M
UniProt Entry Name
HNRPM_HUMAN

NCBI Description

This gene belongs to the subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins and they complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene has three repeats of quasi-RRM domains that bind to RNAs. This protein also constitutes a monomer of the N-acetylglucosamine-specific receptor which is postulated to trigger selective recycling of immature GlcNAc-bearing thyroglobulin molecules. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]

Uniprot Description

hnRNP M: Pre-mRNA binding protein in vivo, binds avidly to poly(G) and poly(U) RNA homopolymers in vitro. Involved in splicing. Acts as a receptor for carcinoembryonic antigen in Kupffer cells, may initiate a series of signaling events leading to tyrosine phosphorylation of proteins and induction of IL-1 alpha, IL-6, IL-10 and tumor necrosis factor alpha cytokines. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Nucleolus; Spliceosome; RNA splicing; RNA-binding; Receptor, misc.

Chromosomal Location of Human Ortholog: 19p13.2

Cellular Component: extracellular matrix; integral to plasma membrane; membrane; nuclear matrix; nucleoplasm; paraspeckles; spliceosome

Molecular Function: protein binding; protein domain specific binding

Biological Process: alternative nuclear mRNA splicing, via spliceosome; fibroblast growth factor receptor signaling pathway; gene expression; nuclear mRNA splicing, via spliceosome

Research Articles on HNRNPM

Similar Products

Product Notes

The HNRNPM hnrnpm (Catalog #AAA1267683) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcag gggtcgaagc ggcggcggag gtggcggcga cggagatcaa aatggaggaa gagagcggcg cgcccggcgt gccgagcggc aacggggctc cgggccctaa gggtgaagga gaacgacctg ctcagaatga gaagaggaag gagaaaaaca taaaaagagg aggcaatcgc tttgagccat atgccaatcc aactaaaaga tacagagcct tcattacaaa catacctttt gatgtgaaat ggcagtcact taaagacctg gttaaagaaa aagttggtga ggtaacatac gtggagctct taatggacgc tgaaggaaag tcaaggggat gtgctgttgt tgaattcaag atggaagaga gcatgaaaaa agctgcggaa gtcctaaaca agcatagtct gagcggaaga ccactgaaag tcaaagaaga tcctgatggt gaacatgcca ggagagcaat gcaaaaggtg atggctacga ctggtgggat gggtatggga ccaggtggcc caggaatgat tactatccca cccagtatcc taaataatcc caacatccca aatgagatta tccatgcatt acaggctgga agacttggaa gcacagtatt tgtagcaaat ctggattata aagttggctg gaagaaactg aaggaagtat ttagtatggc tggtgtggtg gtccgagcag acattcttga agataaagat ggaaaaagtc gtggaatagg cactgttact tttgaacagt ccattgaagc tgtgcaagct atatctatgt tcaatggcca gctgctattt gatagaccaa tgcacgtcaa gatggatgag agggccttac caaaaggaga tttcttccct cctgagcgtc cacaacaact tccccatggc cttggtggta ttggcatggg gttaggacca ggagggcaac ccattgatgc caatcacctg aataaaggca tcggaatggg aaacataggt cccgcaggaa tgggaatgga aggcatagga tttggaataa ataaaatggg aggaatggag gggccctttg gtggtggtat ggaaaacatg ggtcgatttg gatctgggat gaacatgggc aggataaatg aaatcctaag taatgcactg aagagaggag agatcattgc aaagcaggga ggaggtggag gtggaggaag cgtccctggg atcgagagga tgggtcctgg cattgaccgc ctcgggggtg ccggcatgga gcgcatgggc gcgggcctgg gccacggcat ggatcgcgtg ggctccgaga tcgagcgcat gggcctggtc atggaccgca tgggctccgt ggagcgcatg ggctccggca ttgagcgcat gggcccgctg ggcctcgacc acatggcctc cagcattgag cgcatgggcc agaccatgga gcgcattggc tctggcgtgg agcgcatggg tgccggcatg ggcttcggcc ttgagcgcat ggccgctccc atcgaccgtg tgggccagac cattgagcgc atgggctctg gcgtggagcg catgggccct gccatcgagc gcatgggcct gagcatggag cgcatggtgc ccgcaggtat gggagctggc ctggagcgca tgggccccgt gatggatcgc atggccaccg gcctggagcg catgggcgcc aacaatctgg agcggatggg cctggagcgc atgggcgcca acagcctcga gcgcatgggc ctggagcgca tgggtgccaa cagcctcgag cgcatgggcc ccgccatggg cccggccctg ggcgctggca ttgagcgcat gggcctggcc atgggtggcg gtggcggtgc cagctttgac cgtgccatcg agatggagcg tggcaacttc ggaggaagct tcgcaggttc ctttggtgga gctggaggcc atgctcctgg ggtggccagg aaggcctgcc agatatttgt gagaaatctg ccattcgatt tcacatggaa gatgctaaag gacaaattca acgagtgcgg ccacgtgctg tacgccgaca tcaagatgga gaatgggaag tccaaggggt gtggtgtggt taagttcgag tcgccagagg tggccgagag agcctgccgg atgatgaatg gcatgaagct gagtggccga gagattgacg ttcgaattga tagaaacgct taa. It is sometimes possible for the material contained within the vial of "HNRNPM, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.