Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HNRNPK cdna clone

HNRNPK cDNA Clone

Gene Names
HNRNPK; AUKS; CSBP; TUNP; HNRPK
Synonyms
HNRNPK; HNRNPK cDNA Clone; HNRNPK cdna clone
Ordering
For Research Use Only!
Sequence
atggaaactgaacagccagaagaaaccttccctaacactgaaaccaatggtgaatttggtaaacgccctgcagaagatatggaagaggaacaagcatttaaaagatctagaaacactgatgagatggttgaattacgcattctgcttcagagcaagaatgctggggcagtgattggaaaaggaggcaagaatattaaggctctccgtacagactacaatgccagtgtttcagtcccagacagcagtggccccgagcgcatattgagtatcagtgctgatattgaaacaattggagaaattctgaagaaaatcatccctaccttggaagagggcctgcagttgccatcacccactgcaaccagccagctcccgctcgaatctgatgctgtggaatgcttaaattaccaacactataaaggaagtgactttgactgcgagttgaggctgttgattcatcagagtctagcaggaggaattattggggtcaaaggtgctaaaatcaaagaacttcgagagaacactcaaaccaccatcaagcttttccaggaatgctgtcctcattccactgacagagttgttcttattggaggaaaacccgatagggttgtagagtgcataaagatcatccttgatcttatatctgagtctcccatcaaaggacgtgcacagccttatgatcccaatttttacgatgaaacctatgattatggtggttttacaatgatgtttgatgaccgtcgcggacgcccagtgggatttcccatgcggggaagaggtggttttgacagaatgcctcctggtcggggtgggcgtcccatgcctccatctagaagagattatgatgatatgagccctcgtcgaggaccacctccccctcctcccggacgaggcggccggggtggtagcagagctcggaatcttcctcttcctccaccaccaccacctagagggggagacctcatggcctatgacagaagagggagacctggagaccgttacgacggcatggttggtttcagtgctgatgaaacttgggactctgcaatagatacatggagcccatcagaatggcagatggcttatgaaccacagggtggctccggatatgattattcctatgcagggggtcgtggctcatatggtgatcttggtggacctattattactacacaagtaactattcccaaagatttggctggatctattattggcaaaggtggtcagcggattaaacaaatccgtcatgagtcgggagcttcgatcaaaattgatgagcctttagaaggatccgaagatcggatcattaccattacaggaacacaggaccagatacagaatgcacagtatttgctgcagaacagtgtgaagcagtattctggaaagtttttctaa
Sequence Length
1392
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
48,562 Da
NCBI Official Full Name
Homo sapiens heterogeneous nuclear ribonucleoprotein K, mRNA
NCBI Official Synonym Full Names
heterogeneous nuclear ribonucleoprotein K
NCBI Official Symbol
HNRNPK
NCBI Official Synonym Symbols
AUKS; CSBP; TUNP; HNRPK
NCBI Protein Information
heterogeneous nuclear ribonucleoprotein K
UniProt Protein Name
Heterogeneous nuclear ribonucleoprotein K
UniProt Gene Name
HNRNPK
UniProt Synonym Gene Names
HNRPK; hnRNP K; TUNP
UniProt Entry Name
HNRPK_HUMAN

NCBI Description

This gene belongs to the subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins and they complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene is located in the nucleoplasm and has three repeats of KH domains that binds to RNAs. It is distinct among other hnRNP proteins in its binding preference; it binds tenaciously to poly(C). This protein is also thought to have a role during cell cycle progession. Several alternatively spliced transcript variants have been described for this gene, however, not all of them are fully characterized. [provided by RefSeq, Jul 2008]

Uniprot Description

hnRNP K: a heterogeneous nuclear ribonucleoprotein (hnRNP). One of the major pre-mRNA-binding proteins. Binds tenaciously to poly(C) sequences. Likely to play a role in the nuclear metabolism of hnRNAs, particularly for pre-mRNAs that contain cytidine-rich sequences. Can also bind poly(C) single-stranded DNA. Two alternatively spliced isoforms have been described.

Protein type: Spliceosome; RNA-binding; RNA splicing

Chromosomal Location of Human Ortholog: 9q21.32-q21.33

Cellular Component: cell-cell adherens junction; cytoplasm; extracellular matrix; focal adhesion; membrane; nuclear chromatin; nucleoplasm; nucleus

Molecular Function: protein binding; RNA binding; single-stranded DNA binding

Biological Process: gene expression; negative regulation of apoptosis; nuclear mRNA splicing, via spliceosome; positive regulation of low-density lipoprotein receptor biosynthetic process; positive regulation of receptor-mediated endocytosis; positive regulation of transcription from RNA polymerase II promoter; protein sumoylation; RNA processing; signal transduction

Disease: Au-kline Syndrome

Research Articles on HNRNPK

Similar Products

Product Notes

The HNRNPK hnrnpk (Catalog #AAA1276237) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaaactg aacagccaga agaaaccttc cctaacactg aaaccaatgg tgaatttggt aaacgccctg cagaagatat ggaagaggaa caagcattta aaagatctag aaacactgat gagatggttg aattacgcat tctgcttcag agcaagaatg ctggggcagt gattggaaaa ggaggcaaga atattaaggc tctccgtaca gactacaatg ccagtgtttc agtcccagac agcagtggcc ccgagcgcat attgagtatc agtgctgata ttgaaacaat tggagaaatt ctgaagaaaa tcatccctac cttggaagag ggcctgcagt tgccatcacc cactgcaacc agccagctcc cgctcgaatc tgatgctgtg gaatgcttaa attaccaaca ctataaagga agtgactttg actgcgagtt gaggctgttg attcatcaga gtctagcagg aggaattatt ggggtcaaag gtgctaaaat caaagaactt cgagagaaca ctcaaaccac catcaagctt ttccaggaat gctgtcctca ttccactgac agagttgttc ttattggagg aaaacccgat agggttgtag agtgcataaa gatcatcctt gatcttatat ctgagtctcc catcaaagga cgtgcacagc cttatgatcc caatttttac gatgaaacct atgattatgg tggttttaca atgatgtttg atgaccgtcg cggacgccca gtgggatttc ccatgcgggg aagaggtggt tttgacagaa tgcctcctgg tcggggtggg cgtcccatgc ctccatctag aagagattat gatgatatga gccctcgtcg aggaccacct ccccctcctc ccggacgagg cggccggggt ggtagcagag ctcggaatct tcctcttcct ccaccaccac cacctagagg gggagacctc atggcctatg acagaagagg gagacctgga gaccgttacg acggcatggt tggtttcagt gctgatgaaa cttgggactc tgcaatagat acatggagcc catcagaatg gcagatggct tatgaaccac agggtggctc cggatatgat tattcctatg cagggggtcg tggctcatat ggtgatcttg gtggacctat tattactaca caagtaacta ttcccaaaga tttggctgga tctattattg gcaaaggtgg tcagcggatt aaacaaatcc gtcatgagtc gggagcttcg atcaaaattg atgagccttt agaaggatcc gaagatcgga tcattaccat tacaggaaca caggaccaga tacagaatgc acagtatttg ctgcagaaca gtgtgaagca gtattctgga aagtttttct aa. It is sometimes possible for the material contained within the vial of "HNRNPK, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.