Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HMGN1 cdna clone

HMGN1 cDNA Clone

Gene Names
HMGN1; HMG14
Synonyms
HMGN1; HMGN1 cDNA Clone; HMGN1 cdna clone
Ordering
For Research Use Only!
Sequence
atgcccaagaggaaggtcagctccgccgaaggcgccgccaaggaagagcccaagaggagatcggcgcggttgtcagctaaacctcctgcaaaagtggaagcgaagccgaaaaaggcagcagcgaaggataaatcttcagacaaaaaagtgcaaacaaaagggaaaaggggagcaaagggaaaacaggccgaagtggctaaccaagaaactaaagaagacttacctgcggaaaacggggaaacgaagactgaggagagtccagcctctgatgaagcaggagagaaagaagccaagtctgattaa
Sequence Length
303
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
10,659 Da
NCBI Official Full Name
Homo sapiens high-mobility group nucleosome binding domain 1, mRNA
NCBI Official Synonym Full Names
high mobility group nucleosome binding domain 1
NCBI Official Symbol
HMGN1
NCBI Official Synonym Symbols
HMG14
NCBI Protein Information
non-histone chromosomal protein HMG-14
UniProt Protein Name
Non-histone chromosomal protein HMG-14
UniProt Gene Name
HMGN1
UniProt Synonym Gene Names
HMG14
UniProt Entry Name
HMGN1_HUMAN

NCBI Description

The protein encoded by this gene binds nucleosomal DNA and is associated with transcriptionally active chromatin. Along with a similar protein, HMG17, the encoded protein may help maintain an open chromatin configuration around transcribable genes. [provided by RefSeq, Aug 2011]

Uniprot Description

HMGN1: a nonhistone chromosomal protein of the HMG-14/HMG-17 protein family. Binds to the inner side of the nucleosomal DNA thus altering the interaction between the DNA and the histone octamer. May be involved in the process which maintains transcribable genes in a unique chromatin conformation.

Protein type: Nuclear receptor co-regulator; DNA-binding

Chromosomal Location of Human Ortholog: 21q22.2

Cellular Component: nucleoplasm; nucleus

Molecular Function: DNA binding

Biological Process: positive regulation of RNA elongation; transcription-coupled nucleotide-excision repair

Research Articles on HMGN1

Similar Products

Product Notes

The HMGN1 hmgn1 (Catalog #AAA1265977) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcccaaga ggaaggtcag ctccgccgaa ggcgccgcca aggaagagcc caagaggaga tcggcgcggt tgtcagctaa acctcctgca aaagtggaag cgaagccgaa aaaggcagca gcgaaggata aatcttcaga caaaaaagtg caaacaaaag ggaaaagggg agcaaaggga aaacaggccg aagtggctaa ccaagaaact aaagaagact tacctgcgga aaacggggaa acgaagactg aggagagtcc agcctctgat gaagcaggag agaaagaagc caagtctgat taa. It is sometimes possible for the material contained within the vial of "HMGN1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.