HMGCLL1 cdna clone
HMGCLL1 cDNA Clone
Gene Names
HMGCLL1; er-cHL; bA418P12.1
Synonyms
HMGCLL1; HMGCLL1 cDNA Clone; HMGCLL1 cdna clone
Sequence
atggggaatgtgccatccgcggtgaagcactgcctcagctaccagcagcttctccgggagcatctctggatcggggattcagtggcaggggcgctcgaccccgcgcaggaaacatcccagttatctggactccctgagtttgttaaaatagtagaagttgggcctagggatggattgcagaatgaaaaggttatagttcctacagatataaaaattgaatttatcaatcgactttcccaaactggcttgtctgtaatagaagtgactagctttgtgtcttccagatgggtaccacagatggctgatcacactgaagtaatgaaaggcattcatcaatatccaggagttcgctatcctgtccttactcctaatcttcagggttttcaccatgctgttgctgctggagctactgagatatcagtttttggagctgcatctgaatcctttagcaagaagaatattaactgttccattgaagaaagtatgggaaaatttgaggaggttgttaagtctgcaagacacatgaatattccagcacgagggtatgtgtcttgtgctctgggctgtccatatgaaggaagtattacaccgcaaaaagtgacagaagtgtctaagagattgtacggcatgggttgttatgagatctctctaggagacacaattggagtgggaactccaggaagtatgaaaagaatgttggaaagtgtgatgaaagaaatcccaccaggtgctcttgctgttcactgtcatgacacatacggacaagccttagcaaatatccttacggcccttcagatgggaattaatgtggtggactccgcagtatccggattaggtggctgcccttatgcaaaaggtgcttctgggaatgtagccactgaggatttgatatatatgcttaatggcctggggctcaatacaggtgtgaatctatacaaagtgatggaagctggtgactttatttgcaaagctgtgaataaaaccacaaactctaaagtagcacaagcctccttcaatgcttga
Sequence Length
1023
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
32,701 Da
NCBI Official Full Name
Homo sapiens 3-hydroxymethyl-3-methylglutaryl-Coenzyme A lyase-like 1, mRNA
NCBI Official Synonym Full Names
3-hydroxymethyl-3-methylglutaryl-CoA lyase like 1
NCBI Official Symbol
HMGCLL1
NCBI Official Synonym Symbols
er-cHL; bA418P12.1
NCBI Protein Information
3-hydroxymethyl-3-methylglutaryl-CoA lyase, cytoplasmic
UniProt Protein Name
3-hydroxymethyl-3-methylglutaryl-CoA lyase, cytoplasmic
Protein Family
UniProt Gene Name
HMGCLL1
UniProt Synonym Gene Names
er-cHL
UniProt Entry Name
HMGC2_HUMAN
Uniprot Description
HMGCLL1: Non-mitochondrial 3-hydroxymethyl-3-methylglutaryl-CoA lyase that catalyzes a cation-dependent cleavage of (S)-3-hydroxy- 3-methylglutaryl-CoA into acetyl-CoA and acetoacetate, a key step in ketogenesis, the products of which support energy production in nonhepatic animal tissues. Belongs to the HMG-CoA lyase family. 4 isoforms of the human protein are produced by alternative splicing.
Protein type: EC 4.1.3.4; Lyase
Chromosomal Location of Human Ortholog: 6p12.1
Cellular Component: cytosol; endoplasmic reticulum; membrane; perinuclear region of cytoplasm
Molecular Function: hydroxymethylglutaryl-CoA lyase activity; metal ion binding
Biological Process: ketone body biosynthetic process
Research Articles on HMGCLL1
Similar Products
Product Notes
The HMGCLL1 hmgcll1 (Catalog #AAA1269453) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggggaatg tgccatccgc ggtgaagcac tgcctcagct accagcagct tctccgggag catctctgga tcggggattc agtggcaggg gcgctcgacc ccgcgcagga aacatcccag ttatctggac tccctgagtt tgttaaaata gtagaagttg ggcctaggga tggattgcag aatgaaaagg ttatagttcc tacagatata aaaattgaat ttatcaatcg actttcccaa actggcttgt ctgtaataga agtgactagc tttgtgtctt ccagatgggt accacagatg gctgatcaca ctgaagtaat gaaaggcatt catcaatatc caggagttcg ctatcctgtc cttactccta atcttcaggg ttttcaccat gctgttgctg ctggagctac tgagatatca gtttttggag ctgcatctga atcctttagc aagaagaata ttaactgttc cattgaagaa agtatgggaa aatttgagga ggttgttaag tctgcaagac acatgaatat tccagcacga gggtatgtgt cttgtgctct gggctgtcca tatgaaggaa gtattacacc gcaaaaagtg acagaagtgt ctaagagatt gtacggcatg ggttgttatg agatctctct aggagacaca attggagtgg gaactccagg aagtatgaaa agaatgttgg aaagtgtgat gaaagaaatc ccaccaggtg ctcttgctgt tcactgtcat gacacatacg gacaagcctt agcaaatatc cttacggccc ttcagatggg aattaatgtg gtggactccg cagtatccgg attaggtggc tgcccttatg caaaaggtgc ttctgggaat gtagccactg aggatttgat atatatgctt aatggcctgg ggctcaatac aggtgtgaat ctatacaaag tgatggaagc tggtgacttt atttgcaaag ctgtgaataa aaccacaaac tctaaagtag cacaagcctc cttcaatgct tga. It is sometimes possible for the material contained within the vial of "HMGCLL1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
