Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HIST1H2BC cdna clone

HIST1H2BC cDNA Clone

Gene Names
HIST1H2BC; H2B.1; H2B/l; H2BFL; dJ221C16.3
Synonyms
HIST1H2BC; HIST1H2BC cDNA Clone; HIST1H2BC cdna clone
Ordering
For Research Use Only!
Sequence
atgcctgagccagccaagtctgctcccgccccgaagaagggctccaagaaggcagtgaccaaagcgcagaagaaagatggcaagaagcgcaagcgcagccgcaaggagagttactctgtgtacgtgtacaaggtgctgaaacaggtccatcccgacactggcatctcttccaaggccatgggcatcatgaattctttcgttaacgacatatttgagcgcatcgcgggcgaggcttcccgcctggcgcattacaacaagcgctcgaccatcacctccagggagatccagacggccgtgcgcctgctgcttcccggagagctggccaagcacgccgtgtcggagggcaccaaggccgtcaccaagtacaccagctccaagtaa
Sequence Length
381
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
13,906 Da
NCBI Official Full Name
Homo sapiens histone cluster 1, H2bc, mRNA
NCBI Official Synonym Full Names
histone cluster 1 H2B family member c
NCBI Official Symbol
HIST1H2BC
NCBI Official Synonym Symbols
H2B.1; H2B/l; H2BFL; dJ221C16.3
NCBI Protein Information
histone H2B type 1-C/E/F/G/I
UniProt Protein Name
Histone H2B type 1-C/E/F/G/I
Protein Family
UniProt Gene Name
HIST1H2BC
UniProt Synonym Gene Names
H2BFL; H2B/a; H2B/g; H2B/h; H2B/k; H2B/l
UniProt Entry Name
H2B1C_HUMAN

NCBI Description

Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. The protein has antibacterial and antifungal antimicrobial activity. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H2B family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. This gene is found in the large histone gene cluster on chromosome 6. [provided by RefSeq, Aug 2015]

Uniprot Description

H2B1C: a core component of the nucleoosome. The nucleosome, a basic organizational unit of chromosomal DNA, is octrameric, consisting of two molecules each of histones H2B, H2A, H3, H4. The octamer wraps approximately 147 bp of DNA. Nucleosomes wrap and compact DNA into chromatin, limiting DNA accessibility to the cellular machineries which require DNA as a template. Histones thereby play a central role in transcription regulation, DNA repair, DNA replication and chromosomal stability. DNA accessibility is regulated via a complex set of post-translational modifications of histones, also called histone code, and nucleosome remodeling.

Protein type: DNA-binding

Chromosomal Location of Human Ortholog: 6p22.1

Cellular Component: cytoplasm; extracellular space; nucleoplasm; nucleus

Molecular Function: DNA binding; protein binding

Biological Process: antibacterial humoral response; defense response to Gram-positive bacterium; innate immune response in mucosa; nucleosome assembly

Research Articles on HIST1H2BC

Similar Products

Product Notes

The HIST1H2BC hist1h2bc (Catalog #AAA1275660) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcctgagc cagccaagtc tgctcccgcc ccgaagaagg gctccaagaa ggcagtgacc aaagcgcaga agaaagatgg caagaagcgc aagcgcagcc gcaaggagag ttactctgtg tacgtgtaca aggtgctgaa acaggtccat cccgacactg gcatctcttc caaggccatg ggcatcatga attctttcgt taacgacata tttgagcgca tcgcgggcga ggcttcccgc ctggcgcatt acaacaagcg ctcgaccatc acctccaggg agatccagac ggccgtgcgc ctgctgcttc ccggagagct ggccaagcac gccgtgtcgg agggcaccaa ggccgtcacc aagtacacca gctccaagta a. It is sometimes possible for the material contained within the vial of "HIST1H2BC, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.