HFM1 cdna clone
HFM1 cDNA Clone
Gene Names
HFM1; MER3; POF9; Si-11; SEC63D1; Si-11-6; helicase
Synonyms
HFM1; HFM1 cDNA Clone; HFM1 cdna clone
Sequence
atgctgaaatcaaatgattgcctgttttctttggaaaatttgttttttgaaaaaccagatgaagttgaaaaccatccagacaatgaaaagtcattggattggtttctccctcctgctccattgatttcagaaattccagatactcaggagttagaggaagaattagaaagtcataaactgttaggtcaggaaaagaggccaaaaatgttaacatcaaatttaaagataactaatgaagatacaaattatatttcactaacacaaaaattccagtttgcctttccttctgataaatatgaacaggatgatctaaatttagaaggggtaggtaataatgacttatcacatgttgctggcaagctgacatatgcttctcagaaatataaaaatcacattggcactgagatagcacctgagaagagtgttcctgatgatacaaaattagttaattttgcagaagataaaggagagagcacatcagtattccggaaaagattatttaaaatatctgacaatatacatgggagtgcttattctaatgacaatgaattggactctcacattggctcagtgaaaattgtacaaacagaaatgaacaaagggaaatcaaggaactatagcaatagtaagcagaaatttcagtattctgcaaatgtgtttacagcaaataatgctttttctgcttctgaaatcggagaaggcatgttcaaagcaccatctttttcagttgctttccaacctcatgatattcaagaggtaacagaaaatggtttaggttccttgaaggctgtcacagaaattccggcaaaatttagaagtattttcaaagaatttccatatttcaactatatacagtccaaggcctttgatgatcttctttacacagataggaattttgtgatttgtgctccaactggttctggaaaaactgtagtgtttgaactagctataacaagattgttaatggaagtaccattgccatggttgaatattaaaattgtttacatggcaccaataaaagccttgtgcagtcagcgttttgatgactggaaagaaaaatttggaccaataggattgaattgtaaagaacttactggagatacagtaatggatgatctatttgagattcagcatgcccatattattatgacaactccagaaaaatgggatagcatgactaggaaatggagagacaactctttggttcagctggttcgactgtttctcattgatgaggtacatattgtaaaagatgaaaatcgtggtccaactcttgaagttgtagttagcagaatgaaaactgtacagtctgtttctcagactttaaaaaataccagcactgctattccaatgcgatttgtagctgtatctgcaacaattccaaatgctgaggatgtgagttacaattttaactga
Sequence Length
1416
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
62,941 Da
NCBI Official Full Name
Homo sapiens cDNA clone IMAGE:40146845, with apparent retained intron
NCBI Official Synonym Full Names
HFM1, ATP dependent DNA helicase homolog
NCBI Official Symbol
HFM1
NCBI Official Synonym Symbols
MER3; POF9; Si-11; SEC63D1; Si-11-6; helicase
NCBI Protein Information
probable ATP-dependent DNA helicase HFM1
UniProt Protein Name
Probable ATP-dependent DNA helicase HFM1
Protein Family
UniProt Gene Name
HFM1
UniProt Synonym Gene Names
SEC3D1
UniProt Entry Name
HFM1_HUMAN
NCBI Description
The protein encoded by this gene is thought to be an ATP-dependent DNA helicase and is expressed mainly in germ-line cells. Defects in this gene are a cause of premature ovarian failure 9 (POF9). [provided by RefSeq, Apr 2014]
Uniprot Description
SEC63D1: Belongs to the helicase family. SKI2 subfamily. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: DNA-binding; EC 3.6.4.12; Helicase
Chromosomal Location of Human Ortholog: 1p22.2
Disease: Premature Ovarian Failure 9
Research Articles on HFM1
Similar Products
Product Notes
The HFM1 hfm1 (Catalog #AAA1277774) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgaaat caaatgattg cctgttttct ttggaaaatt tgttttttga aaaaccagat gaagttgaaa accatccaga caatgaaaag tcattggatt ggtttctccc tcctgctcca ttgatttcag aaattccaga tactcaggag ttagaggaag aattagaaag tcataaactg ttaggtcagg aaaagaggcc aaaaatgtta acatcaaatt taaagataac taatgaagat acaaattata tttcactaac acaaaaattc cagtttgcct ttccttctga taaatatgaa caggatgatc taaatttaga aggggtaggt aataatgact tatcacatgt tgctggcaag ctgacatatg cttctcagaa atataaaaat cacattggca ctgagatagc acctgagaag agtgttcctg atgatacaaa attagttaat tttgcagaag ataaaggaga gagcacatca gtattccgga aaagattatt taaaatatct gacaatatac atgggagtgc ttattctaat gacaatgaat tggactctca cattggctca gtgaaaattg tacaaacaga aatgaacaaa gggaaatcaa ggaactatag caatagtaag cagaaatttc agtattctgc aaatgtgttt acagcaaata atgctttttc tgcttctgaa atcggagaag gcatgttcaa agcaccatct ttttcagttg ctttccaacc tcatgatatt caagaggtaa cagaaaatgg tttaggttcc ttgaaggctg tcacagaaat tccggcaaaa tttagaagta ttttcaaaga atttccatat ttcaactata tacagtccaa ggcctttgat gatcttcttt acacagatag gaattttgtg atttgtgctc caactggttc tggaaaaact gtagtgtttg aactagctat aacaagattg ttaatggaag taccattgcc atggttgaat attaaaattg tttacatggc accaataaaa gccttgtgca gtcagcgttt tgatgactgg aaagaaaaat ttggaccaat aggattgaat tgtaaagaac ttactggaga tacagtaatg gatgatctat ttgagattca gcatgcccat attattatga caactccaga aaaatgggat agcatgacta ggaaatggag agacaactct ttggttcagc tggttcgact gtttctcatt gatgaggtac atattgtaaa agatgaaaat cgtggtccaa ctcttgaagt tgtagttagc agaatgaaaa ctgtacagtc tgtttctcag actttaaaaa ataccagcac tgctattcca atgcgatttg tagctgtatc tgcaacaatt ccaaatgctg aggatgtgag ttacaatttt aactga. It is sometimes possible for the material contained within the vial of "HFM1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
