Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HES2 cdna clone

HES2

Synonyms
HES2; bHLHb40; HES2 cdna clone
Ordering
For Research Use Only!
Form/Format
Lyophilized
Sequence
Nucleotide Sequence: ATGGGGCTGCCTCGCCGGGCAGGGGACGCGGCGGAGCTGCGCAAGAGCCTGAAGCCGCTGCTGGAGAAGCGCCGGCGCGCGCGCATCAACCAGAGCCTGAGCCAGCTTAAGGGGCTCATCCTGCCGCTGCTGGGCCGGGAGAACTCCAACTGCTCGAAGCTAGAGAAGGCAGACGTCCTGGAAATGACCGTGCGCTTCCTGCAGGAGCTGCCTGCGTCCTCATGGCCCACGGCAGCGCCCCTGCCTTGCGACAGCTACCGCGAGGGCTACAGCGCCTGTGTGGCGCGCCTGGCCCGCGTGCTGCCCGCCTGCCGTGTCCTGGAGCCCGCCGTGAGCGCGCGCCTGCTGGAGCACCTGTGGCGGAGAGCGGCCAGCGCCACCCTGGACGGCGGGCGCGCTGGGGATTCCAGTGGCCCGTCTGCCCCCGCCCCAGCGCCCGCGTCTGCCCCAGAGCCCGCATCCGCTCCGGTGCCCTCGCCGCCCTCGCCTCCCTGCGGCCCTGGCCTCTGGCGGCCGTGGTAG

Translation Sequence: MGLPRRAGDA AELRKSLKPL LEKRRRARIN QSLSQLKGLI LPLLGRENSN CSKLEKADVLEMTVRFLQEL PASSWPTAAP LPCDSYREGY SACVARLARV LPACRVLEPA VSARLLEHLWRRAASATLDG GRAGDSSGPS APAPAPASAP EPASAPVPSP PSPPCGPGLW RPW
Sequence Length
173
Species
Human
Chromosome Location
1p36.31
OMIM Reference Number
609970
cDNA Size
522bp
Vector Description
This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
Vector
(puc19-derived cloning vector)
Preparation Before Usage
1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid.
Preparation and Storage
Store the plasmid at -20 degree C.
Related Product Information for HES2 cdna clone
HES2 is a member of the HES family and contains one basic helix-loop-helix (bHLH) domain and one orange domain. The HES family members form a complex with TLE, the mammalian homologue of Groucho, and this interaction is mediated by the carboxy terminal WRPW motif of the HES proteins. Activation of Notch signaling pathway leads to activation of HES family genes through the interaction between Notch intracellular domain and RBPSuH (CSL). HES2 is expressed in a variety of adult and embryonic tissue.
Product Categories/Family for HES2 cdna clone

NCBI and Uniprot Product Information

NCBI GI #
NCBI Accession #
NCBI GenBank Nucleotide #
UniProt Accession #
NCBI Official Full Name
transcription factor HES-2
UniProt Protein Name
Transcription factor HES-2
Protein Family
UniProt Gene Name
HES2
UniProt Synonym Gene Names
BHLHB40; bHLHb40
UniProt Entry Name
HES2_HUMAN

Uniprot Description

HES2: Transcriptional repressor of genes that require a bHLH protein for their transcription. 2 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 1p36.31

Cellular Component: nucleus

Molecular Function: protein dimerization activity; double-stranded DNA binding; transcription factor binding

Biological Process: transcription, DNA-dependent; negative regulation of transcription, DNA-dependent

Similar Products

Product Notes

The HES2 hes2 (Catalog #AAA200833) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: Nucleotide Sequence: ATGGGGCTGC CTCGCCGGGC AGGGGACGCG GCGGAGCTGC GCAAGAGCCT GAAGCCGCTG CTGGAGAAGC GCCGGCGCGC GCGCATCAAC CAGAGCCTGA GCCAGCTTAA GGGGCTCATC CTGCCGCTGC TGGGCCGGGA GAACTCCAAC TGCTCGAAGC TAGAGAAGGC AGACGTCCTG GAAATGACCG TGCGCTTCCT GCAGGAGCTG CCTGCGTCCT CATGGCCCAC GGCAGCGCCC CTGCCTTGCG ACAGCTACCG CGAGGGCTAC AGCGCCTGTG TGGCGCGCCT GGCCCGCGTG CTGCCCGCCT GCCGTGTCCT GGAGCCCGCC GTGAGCGCGC GCCTGCTGGA GCACCTGTGG CGGAGAGCGG CCAGCGCCAC CCTGGACGGC GGGCGCGCTG GGGATTCCAG TGGCCCGTCT GCCCCCGCCC CAGCGCCCGC GTCTGCCCCA GAGCCCGCAT CCGCTCCGGT GCCCTCGCCG CCCTCGCCTC CCTGCGGCCC TGGCCTCTGG CGGCCGTGGT AG Translatio n Sequence: MGLPRRAGDA AELRKSLKPL LEKRRRARIN QSLSQLKGLI LPLLGRENSN CSKLEKADVL EMTVRFLQEL PASSWPTAAP LPCDSYREGY SACVARLARV LPACRVLEPA VSARLLEHLW RRAASATLDG GRAGDSSGPS APAPAPASAP EPASAPVPSP PSPPCGPGLW RPW. It is sometimes possible for the material contained within the vial of "HES2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.