HDHD2 cdna clone
HDHD2 cDNA Clone
Gene Names
HDHD2; HEL-S-301; 3110052N05Rik
Synonyms
HDHD2; HDHD2 cDNA Clone; HDHD2 cdna clone
Sequence
atgctgctagttgatgatcgggcactacctgatttcaaaggaatacaaacaagtgatcctaatgctgtggtcatgggattggcaccagaacattttcattatcaaattctgaatcaagcattccggttactcctggatggagcacctctgatagcaatccacaaagccaggtattacaagaggaaagatggcttagccctggggcctggaccatttgtgactgctttagagtatgccacagataccaaagccacagtcgtggggaaaccagagaagacgttctttttggaagcattgcggggcactggctgtgaacctgaggaggctgtcatgataggagatgattgcagggatgatgttggtggggctcaagatgtcggcatgctgggcatcttagtaaagactgggaaatatcgagcatcagatgaagaaaaaattaatccacctccttacttaacttgtgagagtttccctcatgctgtggaccacattctgcagcacctattgtga
Sequence Length
510
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
18,533 Da
NCBI Official Full Name
Homo sapiens haloacid dehalogenase-like hydrolase domain containing 2, mRNA
NCBI Official Synonym Full Names
haloacid dehalogenase like hydrolase domain containing 2
NCBI Official Symbol
HDHD2
NCBI Official Synonym Symbols
HEL-S-301; 3110052N05Rik
NCBI Protein Information
haloacid dehalogenase-like hydrolase domain-containing protein 2
UniProt Protein Name
Haloacid dehalogenase-like hydrolase domain-containing protein 2
UniProt Gene Name
HDHD2
UniProt Entry Name
HDHD2_HUMAN
Uniprot Description
HDHD2: Belongs to the HAD-like hydrolase superfamily. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Endoplasmic reticulum; Hydrolase
Chromosomal Location of Human Ortholog: 18q21.1
Molecular Function: enzyme binding; phosphoric monoester hydrolase activity; protein binding
Biological Process: dephosphorylation
Similar Products
Product Notes
The HDHD2 hdhd2 (Catalog #AAA1275124) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgctag ttgatgatcg ggcactacct gatttcaaag gaatacaaac aagtgatcct aatgctgtgg tcatgggatt ggcaccagaa cattttcatt atcaaattct gaatcaagca ttccggttac tcctggatgg agcacctctg atagcaatcc acaaagccag gtattacaag aggaaagatg gcttagccct ggggcctgga ccatttgtga ctgctttaga gtatgccaca gataccaaag ccacagtcgt ggggaaacca gagaagacgt tctttttgga agcattgcgg ggcactggct gtgaacctga ggaggctgtc atgataggag atgattgcag ggatgatgtt ggtggggctc aagatgtcgg catgctgggc atcttagtaa agactgggaa atatcgagca tcagatgaag aaaaaattaa tccacctcct tacttaactt gtgagagttt ccctcatgct gtggaccaca ttctgcagca cctattgtga. It is sometimes possible for the material contained within the vial of "HDHD2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
