Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HAVCR2 cdna clone

HAVCR2 cDNA Clone

Gene Names
HAVCR2; TIM3; CD366; KIM-3; TIMD3; Tim-3; TIMD-3; HAVcr-2
Synonyms
HAVCR2; HAVCR2 cDNA Clone; HAVCR2 cdna clone
Ordering
For Research Use Only!
Sequence
atgttttcacatcttccctttgactgtgtcctgctgctgctgctgctactacttacaaggtcctcagaagtggaatacagagcggaggtcggtcagaatgcctatctgccctgcttctacaccccagccgccccagggaacctcgtgcccgtctgctggggcaaaggagcctgtcctgtgtttgaatgtggcaacgtggtgctcaggactgatgaaagggatgtgaattattggacatccagatactggctaaatggggatttccgcaaaggagatgtgtccctgaccatagagaatgtgactctagcagacagtgggatctactgctgccggatccaaatcccaggcataatgaatgatgaaaaatttaacctgaagttggtcatcaaaccagccaaggtcacccctgcaccgactctgcagagagacttcactgcagcctttccaaggatgcttaccaccaggggacatggcccagcagagacacagacactggggagcctccctgatataaatctaacacaaatatccacattggccaatgagttacgggactctagattggccaatgacttacgggactctggagcaaccatcagaataggcatctacatcggagcagggatctgtgctgggctggctctggctcttatcttcggcgctttaattttcaaatggtattctcatagcaaagagaagatacagaatttaagcctcatctctttggccaacctccctccctcaggattggcaaatgcagtagcagagggaattcgctcagaagaaaacatctataccattgaagagaacgtatatgaagtggaggagcccaatgagtattattgctatgtcagcagcaggcagcaaccctcacaacctttgggttgtcgctttgcaatgccatag
Sequence Length
906
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
16,149 Da
NCBI Official Full Name
Homo sapiens hepatitis A virus cellular receptor 2, mRNA
NCBI Official Synonym Full Names
hepatitis A virus cellular receptor 2
NCBI Official Symbol
HAVCR2
NCBI Official Synonym Symbols
TIM3; CD366; KIM-3; TIMD3; Tim-3; TIMD-3; HAVcr-2
NCBI Protein Information
hepatitis A virus cellular receptor 2
UniProt Protein Name
Hepatitis A virus cellular receptor 2
UniProt Gene Name
HAVCR2
UniProt Synonym Gene Names
TIM3; TIMD3; HAVcr-2; TIMD-3; TIM-3
UniProt Entry Name
HAVR2_HUMAN

NCBI Description

The protein encoded by this gene belongs to the immunoglobulin superfamily, and TIM family of proteins. CD4-positive T helper lymphocytes can be divided into types 1 (Th1) and 2 (Th2) on the basis of their cytokine secretion patterns. Th1 cells are involved in cell-mediated immunity to intracellular pathogens and delayed-type hypersensitivity reactions, whereas, Th2 cells are involved in the control of extracellular helminthic infections and the promotion of atopic and allergic diseases. This protein is a Th1-specific cell surface protein that regulates macrophage activation, and inhibits Th1-mediated auto- and alloimmune responses, and promotes immunological tolerance. [provided by RefSeq, Sep 2011]

Uniprot Description

TIM-3: Regulates macrophage activation. Inhibits T-helper type 1 lymphocyte (Th1)-mediated auto- and alloimmune responses and promotes immunological tolerance. May be also involved in T-cell homing. Receptor for LGALS9. Belongs to the immunoglobulin superfamily. TIM family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Receptor, misc.; Membrane protein, integral

Chromosomal Location of Human Ortholog: 5q33.3

Cellular Component: cell surface

Molecular Function: protein binding

Biological Process: inhibition of NF-kappaB transcription factor; maternal process involved in pregnancy; natural killer cell tolerance induction; negative regulation of interferon-alpha production; negative regulation of interferon-gamma production; negative regulation of interleukin-2 production; negative regulation of interleukin-3 production; negative regulation of myeloid dendritic cell activation; negative regulation of tumor necrosis factor production; positive regulation of interleukin-4 production

Disease: Rheumatoid Arthritis

Research Articles on HAVCR2

Similar Products

Product Notes

The HAVCR2 havcr2 (Catalog #AAA1278314) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttttcac atcttccctt tgactgtgtc ctgctgctgc tgctgctact acttacaagg tcctcagaag tggaatacag agcggaggtc ggtcagaatg cctatctgcc ctgcttctac accccagccg ccccagggaa cctcgtgccc gtctgctggg gcaaaggagc ctgtcctgtg tttgaatgtg gcaacgtggt gctcaggact gatgaaaggg atgtgaatta ttggacatcc agatactggc taaatgggga tttccgcaaa ggagatgtgt ccctgaccat agagaatgtg actctagcag acagtgggat ctactgctgc cggatccaaa tcccaggcat aatgaatgat gaaaaattta acctgaagtt ggtcatcaaa ccagccaagg tcacccctgc accgactctg cagagagact tcactgcagc ctttccaagg atgcttacca ccaggggaca tggcccagca gagacacaga cactggggag cctccctgat ataaatctaa cacaaatatc cacattggcc aatgagttac gggactctag attggccaat gacttacggg actctggagc aaccatcaga ataggcatct acatcggagc agggatctgt gctgggctgg ctctggctct tatcttcggc gctttaattt tcaaatggta ttctcatagc aaagagaaga tacagaattt aagcctcatc tctttggcca acctccctcc ctcaggattg gcaaatgcag tagcagaggg aattcgctca gaagaaaaca tctataccat tgaagagaac gtatatgaag tggaggagcc caatgagtat tattgctatg tcagcagcag gcagcaaccc tcacaacctt tgggttgtcg ctttgcaatg ccatag. It is sometimes possible for the material contained within the vial of "HAVCR2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.