Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HARS cdna clone

HARS cDNA Clone

Gene Names
HARS; HRS; CMT2W; USH3B
Synonyms
HARS; HARS cDNA Clone; HARS cdna clone
Ordering
For Research Use Only!
Sequence
atggcagagcgtgcggcgctggaggagctggtgaaacttcagggagagcgcgtgcgaggcctcaagcagcagaaggccagcgccgagctgatcgaggaggaggtggcgaaactcctgaaactgaaggcacagctgggtcctgatgaaagcaaacagaaatttgtgctcaaaacccccaagggcacaagagactatagtccccggcagatggcagttcgcgagaaggtgtttgacgtaatcatccgttgcttcaagcgccacggtgcagaagtcattgatacacctgtatttgaactaaaggaaacactgatgggaaagtatggggaagactccaagcttatctatgacctgaaggaccagggcggggagctcctgtcccttcgctatgacctcactgttccttttgctcggtatttggcaatgaataaactgaccaacattaaacgctaccacatagcaaaggtatatcggcgggataacccagccatgacccgtggccgataccgggaattctaccagtgtgattttgacattgctgggaactttgatcccatgatccctgatgcagagtgcctgaagatcatgtgcgagatcctgagttcacttcagataggcgacttcctggtcaaggtaaacgatcgacgcattctagatgggatgtttgctatctgtggtgtttctgacagcaagttccgtaccatctgctcctcagtagacaagctggacaaggtgtcctgggaagaggtgaagaatgagatggtgggagagaagggccttgcacctgaggtggctgaccgcattggggactatgtccagcaacatggtggggtatccctggtggaacagctgctccaggatcctaaactatcccaaaacaagcaggccttggagggcctgggagacctgaagttgctctttgagtacctgaccctatttggcattgatgacaaaatctcctttgacctgagccttgctcgagggctggattactacactggggtgatctatgaggcagtgctgctacagaccccagcccaggcaggggaagagcccctgggtgtgggcagtgtggctgctggaggacgctatgatgggctagtgggcatgttcgaccccaaagggcgcaaggtgccatgtgtggggctcagcattggggtggagcggattttctccatcgtggaacagagactagaggctttggaggagaagatacggaccacggagacacaggtgcttgtggcatctgcacagaagaagctgctagaggaaagactaaagcttgtctcagaactgtgggatgctgggatcaaggctgagctgctgtacaagaagaacccaaagctactgaaccagttacagtactgtgaggaggcaggcatcccactggtggctatcatcggcgagcaggaactcaaggatggggtcatcaagctccgttcagtgacgagcagggaagaggtggatgtccgaagagaagaccttgtggaggaaatcaaaaggagaacaggccagcccctctgcatctgctga
Sequence Length
1530
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
54,847 Da
NCBI Official Full Name
Homo sapiens histidyl-tRNA synthetase, mRNA
NCBI Official Synonym Full Names
histidyl-tRNA synthetase
NCBI Official Symbol
HARS
NCBI Official Synonym Symbols
HRS; CMT2W; USH3B
NCBI Protein Information
histidine--tRNA ligase, cytoplasmic
UniProt Protein Name
Histidine--tRNA ligase, cytoplasmic
Protein Family
UniProt Gene Name
HARS
UniProt Synonym Gene Names
HRS; HisRS
UniProt Entry Name
SYHC_HUMAN

NCBI Description

Aminoacyl-tRNA synthetases are a class of enzymes that charge tRNAs with their cognate amino acids. The protein encoded by this gene is a cytoplasmic enzyme which belongs to the class II family of aminoacyl-tRNA synthetases. The enzyme is responsible for the synthesis of histidyl-transfer RNA, which is essential for the incorporation of histidine into proteins. The gene is located in a head-to-head orientation with HARSL on chromosome five, where the homologous genes share a bidirectional promoter. The gene product is a frequent target of autoantibodies in the human autoimmune disease polymyositis/dermatomyositis. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]

Uniprot Description

HARS: Defects in HARS are a cause of Usher syndrome type 3B (USH3B). USH3B is a syndrome characterized by progressive vision and hearing loss during early childhood. Some patients have the so-called 'Charles Bonnet syndrome,' involving decreased visual acuity and vivid visual hallucinations. USH is a genetically heterogeneous condition characterized by the association of retinitis pigmentosa with sensorineural deafness. Age at onset and differences in auditory and vestibular function distinguish Usher syndrome type 1 (USH1), Usher syndrome type 2 (USH2) and Usher syndrome type 3 (USH3). USH3 is characterized by postlingual, progressive hearing loss, variable vestibular dysfunction, and onset of retinitis pigmentosa symptoms, including nyctalopia, constriction of the visual fields, and loss of central visual acuity, usually by the second decade of life. Belongs to the class-II aminoacyl-tRNA synthetase family.

Protein type: EC 6.1.1.21; Ligase; Translation

Chromosomal Location of Human Ortholog: 5q31.3

Cellular Component: cytoplasm; cytosol; mitochondrion

Molecular Function: histidine-tRNA ligase activity

Biological Process: histidyl-tRNA aminoacylation; mitochondrial translation; tRNA aminoacylation for protein translation

Disease: Charcot-marie-tooth Disease, Axonal, Type 2w; Usher Syndrome, Type Iiib

Research Articles on HARS

Similar Products

Product Notes

The HARS hars (Catalog #AAA1270869) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcagagc gtgcggcgct ggaggagctg gtgaaacttc agggagagcg cgtgcgaggc ctcaagcagc agaaggccag cgccgagctg atcgaggagg aggtggcgaa actcctgaaa ctgaaggcac agctgggtcc tgatgaaagc aaacagaaat ttgtgctcaa aacccccaag ggcacaagag actatagtcc ccggcagatg gcagttcgcg agaaggtgtt tgacgtaatc atccgttgct tcaagcgcca cggtgcagaa gtcattgata cacctgtatt tgaactaaag gaaacactga tgggaaagta tggggaagac tccaagctta tctatgacct gaaggaccag ggcggggagc tcctgtccct tcgctatgac ctcactgttc cttttgctcg gtatttggca atgaataaac tgaccaacat taaacgctac cacatagcaa aggtatatcg gcgggataac ccagccatga cccgtggccg ataccgggaa ttctaccagt gtgattttga cattgctggg aactttgatc ccatgatccc tgatgcagag tgcctgaaga tcatgtgcga gatcctgagt tcacttcaga taggcgactt cctggtcaag gtaaacgatc gacgcattct agatgggatg tttgctatct gtggtgtttc tgacagcaag ttccgtacca tctgctcctc agtagacaag ctggacaagg tgtcctggga agaggtgaag aatgagatgg tgggagagaa gggccttgca cctgaggtgg ctgaccgcat tggggactat gtccagcaac atggtggggt atccctggtg gaacagctgc tccaggatcc taaactatcc caaaacaagc aggccttgga gggcctggga gacctgaagt tgctctttga gtacctgacc ctatttggca ttgatgacaa aatctccttt gacctgagcc ttgctcgagg gctggattac tacactgggg tgatctatga ggcagtgctg ctacagaccc cagcccaggc aggggaagag cccctgggtg tgggcagtgt ggctgctgga ggacgctatg atgggctagt gggcatgttc gaccccaaag ggcgcaaggt gccatgtgtg gggctcagca ttggggtgga gcggattttc tccatcgtgg aacagagact agaggctttg gaggagaaga tacggaccac ggagacacag gtgcttgtgg catctgcaca gaagaagctg ctagaggaaa gactaaagct tgtctcagaa ctgtgggatg ctgggatcaa ggctgagctg ctgtacaaga agaacccaaa gctactgaac cagttacagt actgtgagga ggcaggcatc ccactggtgg ctatcatcgg cgagcaggaa ctcaaggatg gggtcatcaa gctccgttca gtgacgagca gggaagaggt ggatgtccga agagaagacc ttgtggagga aatcaaaagg agaacaggcc agcccctctg catctgctga. It is sometimes possible for the material contained within the vial of "HARS, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.