Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HAO1 cdna clone

HAO1 cDNA Clone

Gene Names
HAO1; GOX; GOX1; HAOX1
Synonyms
HAO1; HAO1 cDNA Clone; HAO1 cdna clone
Ordering
For Research Use Only!
Sequence
atgctcccccggctaatttgtatcaatgattatgaacaacatgctaaatcagtacttccaaagtctatatatgactattacaggtctggggcaaatgatgaagaaactttggctgataatattgcagcattttccagatggaagctgtatccaaggatgctccggaatgttgctgaaacagatctgtcgacttctgttttaggacagagggtcagcatgccaatatgtgtgggggctacggccatgcagcgcatggctcatgtggacggcgagcttgccactgtgagagcctgtcagtccctgggaacgggcatgatgttgagttcctgggccacctcctcaattgaagaagtggcggaagctggtcctgaggcacttcgttggctgcaactgtatatctacaaggaccgagaagtcaccaagaagctagtgcggcaggcagagaagatgggctacaaggccatatttgtgacagtggacacaccttacctgggcaaccgtctggatgatgtgcgtaacagattcaaactgccgccacaactcaggatgaaaaattttgaaaccagtactttatcattttctcctgaggaaaattttggagacgacagtggacttgctgcatatgtggctaaagcaatagacccatctatcagctgggaagatatcaaatggctgagaagactgacatcattgccaattgttgcaaagggcattttgagaggtgatgatgccagggaggctgttaaacatggcttgaatgggatcttggtgtcgaatcatggggctcgacaactcgatggggtgccagccactattgatgttctgccagaaattgtggaggctgtggaagggaaggtggaagtcttcctggacgggggtgtgcggaaaggcactgatgttctgaaagctctggctcttggcgccaaggctgtgtttgtggggagaccaatcgtttggggcttagctttccagggggagaaaggtgttcaagatgtcctcgagatactaaaggaagaattccggttggccatggctctgagtgggtgccagaatgtgaaagtcatcgacaagacattggtgaggaaaaatcctttggccgtttccaagatctga
Sequence Length
1113
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
40,924 Da
NCBI Official Full Name
Homo sapiens hydroxyacid oxidase (glycolate oxidase) 1, mRNA
NCBI Official Synonym Full Names
hydroxyacid oxidase 1
NCBI Official Symbol
HAO1
NCBI Official Synonym Symbols
GOX; GOX1; HAOX1
NCBI Protein Information
hydroxyacid oxidase 1
UniProt Protein Name
Hydroxyacid oxidase 1
Protein Family
UniProt Gene Name
HAO1
UniProt Synonym Gene Names
GOX1; HAOX1; HAOX1; GOX
UniProt Entry Name
HAOX1_HUMAN

NCBI Description

This gene is one of three related genes that have 2-hydroxyacid oxidase activity yet differ in encoded protein amino acid sequence, tissue expression and substrate preference. Subcellular location of the encoded protein is the peroxisome. Specifically, this gene is expressed primarily in liver and pancreas and the encoded protein is most active on glycolate, a two-carbon substrate. The protein is also active on 2-hydroxy fatty acids. The transcript detected at high levels in pancreas may represent an alternatively spliced form or the use of a multiple near-consensus upstream polyadenylation site. [provided by RefSeq, Jul 2008]

Uniprot Description

HAO1: Has 2-hydroxyacid oxidase activity. Most active on the 2-carbon substrate glycolate, but is also active on 2-hydroxy fatty acids, with high activity towards 2-hydroxy palmitate and 2- hydroxy octanoate. Belongs to the FMN-dependent alpha-hydroxy acid dehydrogenase family.

Protein type: EC 1.1.3.15; Oxidoreductase; Carbohydrate Metabolism - glyoxylate and dicarboxylate

Chromosomal Location of Human Ortholog: 20p12

Cellular Component: peroxisomal matrix; peroxisome

Molecular Function: (S)-2-hydroxy-acid oxidase activity; FMN binding; glycolate oxidase activity; glyoxylate oxidase activity; receptor binding

Biological Process: fatty acid alpha-oxidation; glycolate catabolic process; glyoxylate metabolic process

Research Articles on HAO1

Similar Products

Product Notes

The HAO1 hao1 (Catalog #AAA1272554) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctccccc ggctaatttg tatcaatgat tatgaacaac atgctaaatc agtacttcca aagtctatat atgactatta caggtctggg gcaaatgatg aagaaacttt ggctgataat attgcagcat tttccagatg gaagctgtat ccaaggatgc tccggaatgt tgctgaaaca gatctgtcga cttctgtttt aggacagagg gtcagcatgc caatatgtgt gggggctacg gccatgcagc gcatggctca tgtggacggc gagcttgcca ctgtgagagc ctgtcagtcc ctgggaacgg gcatgatgtt gagttcctgg gccacctcct caattgaaga agtggcggaa gctggtcctg aggcacttcg ttggctgcaa ctgtatatct acaaggaccg agaagtcacc aagaagctag tgcggcaggc agagaagatg ggctacaagg ccatatttgt gacagtggac acaccttacc tgggcaaccg tctggatgat gtgcgtaaca gattcaaact gccgccacaa ctcaggatga aaaattttga aaccagtact ttatcatttt ctcctgagga aaattttgga gacgacagtg gacttgctgc atatgtggct aaagcaatag acccatctat cagctgggaa gatatcaaat ggctgagaag actgacatca ttgccaattg ttgcaaaggg cattttgaga ggtgatgatg ccagggaggc tgttaaacat ggcttgaatg ggatcttggt gtcgaatcat ggggctcgac aactcgatgg ggtgccagcc actattgatg ttctgccaga aattgtggag gctgtggaag ggaaggtgga agtcttcctg gacgggggtg tgcggaaagg cactgatgtt ctgaaagctc tggctcttgg cgccaaggct gtgtttgtgg ggagaccaat cgtttggggc ttagctttcc agggggagaa aggtgttcaa gatgtcctcg agatactaaa ggaagaattc cggttggcca tggctctgag tgggtgccag aatgtgaaag tcatcgacaa gacattggtg aggaaaaatc ctttggccgt ttccaagatc tga. It is sometimes possible for the material contained within the vial of "HAO1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.