Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GRAMD3 cdna clone

GRAMD3 cDNA Clone

Gene Names
GRAMD3; NS3TP2
Synonyms
GRAMD3; GRAMD3 cDNA Clone; GRAMD3 cdna clone
Ordering
For Research Use Only!
Sequence
atgactgaactacagcaagatgtggaagacacaaagcctgcgaaagtgctcgggaagagggagagcaaacttggctcagcccactcagaggctgagaatggtgtggaggagaaaaagaaagcctgcaggtcgccaacagcccaatcccctaccccatctgtggaggcggactccccagaccagaagaaaatcattagcctatggtcaaaatccagttttgatggtgcctctttagcaagtgataagaacgactgtaaaacagaaagcaaaaatgaccctaagactgaaagaaaaaagtcttcatcttccagccagtacaaggccaatatgcactttcacaagttgtttcttagtgtcccaacggaggaaccactgaagcaaagctttacctgtgctctacagaaagaaatactataccaaggaaagctctttgtatcagaaaactggatttgttttcattccaaagtctttggaaaagacacaaagatctctattccagctttctcggtaaccctaataaagaaaaccaaaactgctcttctagtgccaaacgccctgatcatagcaacagtcacagacaggtacatatttgtctccttactctccagagattcaacttacaaactactaaaatctgtgtgtggacacttagaaaatacaagtgttggtaacagtcccaatccatcttctgctgaaaacagtttccgagcagaccgcccttcatctctgcctctggatttcaatgatgaattctcagatctggatggagtggttcaacaaagaaggcaagacatggaaggatatagcagttctggttctcaaactcctgaatctgagaactctcgagatttccatgcgacagaatcccaaacagttctgaatgtctccaagggagaagcaaagccaactcgggcagatgcccatgtgaacagagtacctgaaggaaaagccaagagtctccctgtacagggtctgtcagaaactgttggaatcttacataaagtcaagtctcagaaatgtccgatgcttcaccatattcttatattctatgcaattgttgtctgtgcactaatcatctcgaccttctacatgagatacagaattaatactctggaggagcagctggggttactaacctccattgtggacacccataatactgaacaggcagcaccatctggcctgaggtcacaagtacaattcaatgtggaggttctctgtcaagagcttacagctaacatagtgaaattagaaaagatacaaaataacttacagaagttgcttgagaatggtgactga
Sequence Length
1299
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
36,649 Da
NCBI Official Full Name
Homo sapiens GRAM domain containing 3, mRNA
NCBI Official Synonym Full Names
GRAM domain containing 3
NCBI Official Symbol
GRAMD3
NCBI Official Synonym Symbols
NS3TP2
NCBI Protein Information
GRAM domain-containing protein 3
UniProt Protein Name
GRAM domain-containing protein 3
UniProt Gene Name
GRAMD3
UniProt Synonym Gene Names
NS3TP2
UniProt Entry Name
GRAM3_HUMAN

Uniprot Description

GRAMD3: 5 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 5q23.2

Cellular Component: cytoplasmic microtubule

Molecular Function: protein binding

Research Articles on GRAMD3

Similar Products

Product Notes

The GRAMD3 gramd3 (Catalog #AAA1275786) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgactgaac tacagcaaga tgtggaagac acaaagcctg cgaaagtgct cgggaagagg gagagcaaac ttggctcagc ccactcagag gctgagaatg gtgtggagga gaaaaagaaa gcctgcaggt cgccaacagc ccaatcccct accccatctg tggaggcgga ctccccagac cagaagaaaa tcattagcct atggtcaaaa tccagttttg atggtgcctc tttagcaagt gataagaacg actgtaaaac agaaagcaaa aatgacccta agactgaaag aaaaaagtct tcatcttcca gccagtacaa ggccaatatg cactttcaca agttgtttct tagtgtccca acggaggaac cactgaagca aagctttacc tgtgctctac agaaagaaat actataccaa ggaaagctct ttgtatcaga aaactggatt tgttttcatt ccaaagtctt tggaaaagac acaaagatct ctattccagc tttctcggta accctaataa agaaaaccaa aactgctctt ctagtgccaa acgccctgat catagcaaca gtcacagaca ggtacatatt tgtctcctta ctctccagag attcaactta caaactacta aaatctgtgt gtggacactt agaaaataca agtgttggta acagtcccaa tccatcttct gctgaaaaca gtttccgagc agaccgccct tcatctctgc ctctggattt caatgatgaa ttctcagatc tggatggagt ggttcaacaa agaaggcaag acatggaagg atatagcagt tctggttctc aaactcctga atctgagaac tctcgagatt tccatgcgac agaatcccaa acagttctga atgtctccaa gggagaagca aagccaactc gggcagatgc ccatgtgaac agagtacctg aaggaaaagc caagagtctc cctgtacagg gtctgtcaga aactgttgga atcttacata aagtcaagtc tcagaaatgt ccgatgcttc accatattct tatattctat gcaattgttg tctgtgcact aatcatctcg accttctaca tgagatacag aattaatact ctggaggagc agctggggtt actaacctcc attgtggaca cccataatac tgaacaggca gcaccatctg gcctgaggtc acaagtacaa ttcaatgtgg aggttctctg tcaagagctt acagctaaca tagtgaaatt agaaaagata caaaataact tacagaagtt gcttgagaat ggtgactga. It is sometimes possible for the material contained within the vial of "GRAMD3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.