GRAMD1C cdna clone
GRAMD1C cDNA Clone
Synonyms
GRAMD1C; GRAMD1C cDNA Clone; GRAMD1C cdna clone
Sequence
atgtttgaattgctctttaccagttcacgctttatgcagaaatttgccagttctagaaatataatagatgtagtatctaccccttggactgcagaacttggaggtgatcagctgagaacgatgacctacactatagtccttaatagtccacttactggaaaatgcactgctgccactgaaaagcagacactgtataaagaaagtcgggaagcacgattttatttggtagattcagaagtactgacacatgatgtcccctaccatgattacttctataccgtgaacagatactgtatcatccgatcttcaaaacagaaatgcaggctaagagtttccacagatttgaaatacagaaaacagccatggggccttgtcaaatctttaattgaaaagaattcctggagttctttggaggactatttcaaacagcttgaatcagatttgttaattgaagaatctgtattaaatcaggccattgaggacgcagttcatcatactggcctacgaaggagaaggcgaaccttcaaccgaacagcagaaacagttcctaaactttcctctcagcattcctctggagatgtgggcttaggtgccaaaggggatattacaggaaagaaaaaggaaatggaaaactataacgtcactcttattgtggtaatgagtatttttgtgttgttattagttttgttgaatgtgacactgtttctgaagctgtcaaagatagaacatgctgctcagtccttttaccgtctccgcctccaagaagagaaatctttaaatttagcctctgatatggtgtcaagagcagaaactattcagaagaataaagatcaggcccatcgtttaaagggagtgctccgagactccatagtgatgcttgaacagctgaagagctcactcattatgcttcagaaaacgtttgatctactaaataagaataagactggcatggctgttgaaagctag
Sequence Length
966
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
52,015 Da
NCBI Official Full Name
Homo sapiens GRAM domain containing 1C, mRNA
NCBI Official Synonym Full Names
GRAM domain containing 1C
NCBI Official Symbol
GRAMD1C
NCBI Protein Information
GRAM domain-containing protein 1C
UniProt Protein Name
GRAM domain-containing protein 1C
Protein Family
UniProt Gene Name
GRAMD1C
UniProt Entry Name
GRM1C_HUMAN
Uniprot Description
GRAMD1C: 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Membrane protein, integral
Chromosomal Location of Human Ortholog: 3q13.31
Molecular Function: protein binding
Similar Products
Product Notes
The GRAMD1C gramd1c (Catalog #AAA1276580) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtttgaat tgctctttac cagttcacgc tttatgcaga aatttgccag ttctagaaat ataatagatg tagtatctac cccttggact gcagaacttg gaggtgatca gctgagaacg atgacctaca ctatagtcct taatagtcca cttactggaa aatgcactgc tgccactgaa aagcagacac tgtataaaga aagtcgggaa gcacgatttt atttggtaga ttcagaagta ctgacacatg atgtccccta ccatgattac ttctataccg tgaacagata ctgtatcatc cgatcttcaa aacagaaatg caggctaaga gtttccacag atttgaaata cagaaaacag ccatggggcc ttgtcaaatc tttaattgaa aagaattcct ggagttcttt ggaggactat ttcaaacagc ttgaatcaga tttgttaatt gaagaatctg tattaaatca ggccattgag gacgcagttc atcatactgg cctacgaagg agaaggcgaa ccttcaaccg aacagcagaa acagttccta aactttcctc tcagcattcc tctggagatg tgggcttagg tgccaaaggg gatattacag gaaagaaaaa ggaaatggaa aactataacg tcactcttat tgtggtaatg agtatttttg tgttgttatt agttttgttg aatgtgacac tgtttctgaa gctgtcaaag atagaacatg ctgctcagtc cttttaccgt ctccgcctcc aagaagagaa atctttaaat ttagcctctg atatggtgtc aagagcagaa actattcaga agaataaaga tcaggcccat cgtttaaagg gagtgctccg agactccata gtgatgcttg aacagctgaa gagctcactc attatgcttc agaaaacgtt tgatctacta aataagaata agactggcat ggctgttgaa agctag. It is sometimes possible for the material contained within the vial of "GRAMD1C, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
