Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GPR65 cdna clone

GPR65 cDNA Clone

Gene Names
GPR65; TDAG8; hTDAG8
Synonyms
GPR65; GPR65 cDNA Clone; GPR65 cdna clone
Ordering
For Research Use Only!
Sequence
atgaacagcacatgtattgaagaacagcatgacctggatcactatttgtttcccattgtttacatctttgtgattatagtcagcattccagccaatattggatctctgtgtgtgtctttcctgcaagcaaagaaggaaagtgaactaggaatttacctcttcagtttgtcactatcagatttactctatgcattaactctccctttatggattgattatacttggaataaagacaactggactttctctcctgccttgtgcaaagggagtgcttttctcatgtacatgaatttttacagcagcacagcattcctcacctgcattgccgttgatcggtatttggctgttgtctaccctttgaagttttttttcctaaggacaagaagatttgcactcatggtcagcctgtccatctggatattggaaaccatcttcaatgctgtcatgttgtgggaagatgaaacagttgttgaatattgcgatgccgaaaagtctaattttactttatgctatgacaaataccctttagagaaatggcaaatcaacctcaacttgttcaggacgtgtacaggctatgcaatacctttggtcaccatcctgatctgcaaccggaaagtctaccaagctgtgcggcacaataaagccacggaaaacaaggaaaagaagagaatcataaaactacttgtcagcatcacagttacttttgtcttatgctttactccctttcatgtgatgttgctgattcgctgcattttagagcatgctgtgaacttcgaagaccacagcaattctgggaagcgaacttacacaatgtatagaatcacggttgcattaacaagtttaaattgtgttgctgatccaattctgtactgttttgtaaccgaaacaggaagatatgatatgtggaatatattaaaattctgcactgggaggtgtaatacatcacaaagacaaagaaaacgcatactttctgtgtctacaaaagatactatggaattagaggtccttgagtag
Sequence Length
1014
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
39,333 Da
NCBI Official Full Name
Homo sapiens G protein-coupled receptor 65, mRNA
NCBI Official Synonym Full Names
G protein-coupled receptor 65
NCBI Official Symbol
GPR65
NCBI Official Synonym Symbols
TDAG8; hTDAG8
NCBI Protein Information
psychosine receptor
UniProt Protein Name
Psychosine receptor
Protein Family
UniProt Gene Name
GPR65
UniProt Synonym Gene Names
TDAG8
UniProt Entry Name
PSYR_HUMAN

Uniprot Description

GPR65: Receptor for the glycosphingolipid psychosine (PSY) and several related glycosphingolipids. May have a role in activation- induced cell death or differentiation of T-cells. Belongs to the G-protein coupled receptor 1 family.

Protein type: GPCR, family 1; Membrane protein, integral; Receptor, GPCR; Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: 14q31-q32.1

Cellular Component: integral to plasma membrane; plasma membrane

Molecular Function: G-protein coupled receptor activity

Biological Process: actin cytoskeleton reorganization; G-protein coupled receptor protein signaling pathway; immune response; multicellular organismal development; positive regulation of cAMP biosynthetic process; positive regulation of stress fiber formation; response to acidity

Research Articles on GPR65

Similar Products

Product Notes

The GPR65 gpr65 (Catalog #AAA1266605) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaacagca catgtattga agaacagcat gacctggatc actatttgtt tcccattgtt tacatctttg tgattatagt cagcattcca gccaatattg gatctctgtg tgtgtctttc ctgcaagcaa agaaggaaag tgaactagga atttacctct tcagtttgtc actatcagat ttactctatg cattaactct ccctttatgg attgattata cttggaataa agacaactgg actttctctc ctgccttgtg caaagggagt gcttttctca tgtacatgaa tttttacagc agcacagcat tcctcacctg cattgccgtt gatcggtatt tggctgttgt ctaccctttg aagttttttt tcctaaggac aagaagattt gcactcatgg tcagcctgtc catctggata ttggaaacca tcttcaatgc tgtcatgttg tgggaagatg aaacagttgt tgaatattgc gatgccgaaa agtctaattt tactttatgc tatgacaaat accctttaga gaaatggcaa atcaacctca acttgttcag gacgtgtaca ggctatgcaa tacctttggt caccatcctg atctgcaacc ggaaagtcta ccaagctgtg cggcacaata aagccacgga aaacaaggaa aagaagagaa tcataaaact acttgtcagc atcacagtta cttttgtctt atgctttact ccctttcatg tgatgttgct gattcgctgc attttagagc atgctgtgaa cttcgaagac cacagcaatt ctgggaagcg aacttacaca atgtatagaa tcacggttgc attaacaagt ttaaattgtg ttgctgatcc aattctgtac tgttttgtaa ccgaaacagg aagatatgat atgtggaata tattaaaatt ctgcactggg aggtgtaata catcacaaag acaaagaaaa cgcatacttt ctgtgtctac aaaagatact atggaattag aggtccttga gtag. It is sometimes possible for the material contained within the vial of "GPR65, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.