GPR119 cdna clone

GPR119 cDNA Clone

Gene Names

GPR119; GPCR2

Synonyms

GPR119; GPR119 cDNA Clone; GPR119 cdna clone

Ordering
Cat. Num. AAA1266335 When autocomplete results are available use up and down arrows to review and enter to select. Touch device users, explore by touch or with swipe gestures. For Research Use Only!

Sequence

atggaatcatctttctcatttggagtgatccttgctgtcctggcctccctcatcattgctactaacacactagtggctgtggctgtgctgctgttgatccacaagaatgatggtgtcagtctctgcttcaccttgaatctggctgtggctgacaccttgattggtgtggccatctctggcctactcacagaccagctctccagcccttctcggcccacacagaagaccctgtgcagcctgcggatggcatttgtcacttcctccgcagctgcctctgtcctcacggtcatgctgatcacctttgacaggtaccttgccatcaagcagcccttccgctacttgaagatcatgagtgggttcgtggccggggcctgcattgccgggctgtggttagtgtcttacctcattggcttcctcccactcggaatccccatgttccagcagactgcctacaaagggcagtgcagcttctttgctgtatttcaccctcacttcgtgctgaccctctcctgcgttggcttcttcccagccatgctcctctttgtcttcttctactgcgacatgctcaagattgcctccatgcacagccagcagattcgaaagatggaacatgcaggagccatggctggaggttatcgatccccacggactcccagcgacttcaaagctctccgtactgtgtctgttctcattgggagctttgctctatcctggacccccttccttatcactggcattgtgcaggtggcctgccaggagtgtcacctctacctagtgctggaacggtacctgtggctgctcggcgtgggcaactccctgctcaacccactcatctatgcctattggcagaaggaggtgcgactgcagctctaccacatggccctaggagtgaagaaggtgctcacctcattcctcctctttctctcggccaggaattgtggcccagagaggcccagggaaagttcctgtcacatcgtcactatctccagctcagagtttgatggctaa

Sequence Length

1008

Vector

pENTR223.1 or pUC

Clone Sequence Report

Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #

116496968

NCBI GeneID

139760

Molecular Weight

36,889 Da

NCBI Official Full Name

Homo sapiens G protein-coupled receptor 119, mRNA

NCBI Official Synonym Full Names

G protein-coupled receptor 119

NCBI Official Symbol

GPR119

NCBI Official Synonym Symbols

GPCR2

NCBI Protein Information

glucose-dependent insulinotropic receptor

UniProt Protein Name

Glucose-dependent insulinotropic receptor

Protein Family

Glucose-dependent insulinotropic receptor

UniProt Gene Name

GPR119

UniProt Entry Name

GP119_HUMAN

NCBI Description

This gene encodes a member of the rhodopsin subfamily of G-protein-coupled receptors that is expressed in the pancreas and gastrointestinal tract. The encoded protein is activated by lipid amides including lysophosphatidylcholine and oleoylethanolamide and may be involved in glucose homeostasis. This protein is a potential drug target in the treatment of type 2 diabetes.[provided by RefSeq, Jan 2010]

Uniprot Description

GPR119: Receptor for the endogenous fatty-acid ethanolamide oleoylethanolamide (OEA) and lysophosphatidylcholine (LPC). Functions as a glucose-dependent insulinotropic receptor. The activity of this receptor is mediated by G proteins which activate adenylate cyclase. Seems to act through a G(s) mediated pathway. Belongs to the G-protein coupled receptor 1 family.

Protein type: GPCR, family 1; Membrane protein, multi-pass; Receptor, GPCR; Membrane protein, integral

Chromosomal Location of Human Ortholog: Xq26.1

Cellular Component: receptor complex

Research Articles on GPR119

1. Describe novel small-molecule GPR119 agonists with high receptor selectivity and capacity to induce glucose-stimulated insulin secretion.

Similar Products

Product Notes

The GPR119 gpr119 (Catalog #AAA1266335) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaatcat ctttctcatt tggagtgatc cttgctgtcc tggcctccct catcattgct actaacacac tagtggctgt ggctgtgctg ctgttgatcc acaagaatga tggtgtcagt ctctgcttca ccttgaatct ggctgtggct gacaccttga ttggtgtggc catctctggc ctactcacag accagctctc cagcccttct cggcccacac agaagaccct gtgcagcctg cggatggcat ttgtcacttc ctccgcagct gcctctgtcc tcacggtcat gctgatcacc tttgacaggt accttgccat caagcagccc ttccgctact tgaagatcat gagtgggttc gtggccgggg cctgcattgc cgggctgtgg ttagtgtctt acctcattgg cttcctccca ctcggaatcc ccatgttcca gcagactgcc tacaaagggc agtgcagctt ctttgctgta tttcaccctc acttcgtgct gaccctctcc tgcgttggct tcttcccagc catgctcctc tttgtcttct tctactgcga catgctcaag attgcctcca tgcacagcca gcagattcga aagatggaac atgcaggagc catggctgga ggttatcgat ccccacggac tcccagcgac ttcaaagctc tccgtactgt gtctgttctc attgggagct ttgctctatc ctggaccccc ttccttatca ctggcattgt gcaggtggcc tgccaggagt gtcacctcta cctagtgctg gaacggtacc tgtggctgct cggcgtgggc aactccctgc tcaacccact catctatgcc tattggcaga aggaggtgcg actgcagctc taccacatgg ccctaggagt gaagaaggtg ctcacctcat tcctcctctt tctctcggcc aggaattgtg gcccagagag gcccagggaa agttcctgtc acatcgtcac tatctccagc tcagagtttg atggctaa. It is sometimes possible for the material contained within the vial of "GPR119, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Loading...

GPR119 cdna clone