Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GOT1 cdna clone

GOT1 cDNA Clone

Gene Names
GOT1; AST1; cCAT; GIG18; cAspAT; ASTQTL1
Synonyms
GOT1; GOT1 cDNA Clone; GOT1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcacctccgtcagtctttgccgaggttccgcaggcccagcctgtcctggtcttcaagctcactgccgacttcagggaggatccggacccccgcaaggtcaacctgggagtgggagcatatcgcacggatgactgccatccctgggttttgccagtagtgaagaaagtggagcagaagattgctaatgacaatagcctaaatcacgagtatctgccaatcctgggcctggctgagttccggagctgtgcttctcgtcttgcccttggggatgacagcccagcactcaaggagaagcgggtaggaggtgtgcaatctttggggggaacaggtgcacttcgaattggagctgatttcttagcgcgttggtacaatggaacaaacaacaagaacacacctgtctatgtgtcctcaccaacctgggagaatcacaatgctgtgttttccgctgctggttttaaagacattcggtcctatcgctactgggatgcagagaagagaggattggacctccagggcttcctgaatgatctggagaatgctcctgagttctccattgttgtcctccacgcctgtgcacacaacccaactgggattgacccaactccggagcagtggaagcagattgcttctgtcatgaagcaccggtttctgttccccttctttgactcagcctatcagggcttcgcatctggaaacctggagagagatgcctgggccattcgctattttgtgtctgaaggcttcgagttcttctgtgcccagtccttctccaagaacttcgggctctacaatgagagagtcgggaatctgactgtggttggaaaagaacctgagagcatcctgcaagtcctttcccagatggagaagatcgtgcggattacttggtccaatccccccgcccagggagcacgaattgtggccagcaccctctctaaccctgagctctttgaggaatggacaggtaatgtgaagacaatggctgaccggattctgaccatgagatctgaactcagggcacgactagaagccctcaaaacccctgggacctggaaccacatcactgatcaaattggcatgttcagcttcactgggttgaaccccaagcaggttgagtatctggtcaatgaaaagcacatctacctgctgccaagtggtcgaatcaacgtgagtggcttaaccaccaaaaatctagattacgtggccacctccatccatgaagcagtcaccaaaatccagtga
Sequence Length
1242
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
44,147 Da
NCBI Official Full Name
Homo sapiens glutamic-oxaloacetic transaminase 1, soluble (aspartate aminotransferase 1), mRNA
NCBI Official Synonym Full Names
glutamic-oxaloacetic transaminase 1
NCBI Official Symbol
GOT1
NCBI Official Synonym Symbols
AST1; cCAT; GIG18; cAspAT; ASTQTL1
NCBI Protein Information
aspartate aminotransferase, cytoplasmic
UniProt Protein Name
Aspartate aminotransferase, cytoplasmic
Protein Family
UniProt Gene Name
GOT1
UniProt Synonym Gene Names
cAspAT; cCAT
UniProt Entry Name
AATC_HUMAN

NCBI Description

Glutamic-oxaloacetic transaminase is a pyridoxal phosphate-dependent enzyme which exists in cytoplasmic and mitochondrial forms, GOT1 and GOT2, respectively. GOT plays a role in amino acid metabolism and the urea and tricarboxylic acid cycles. The two enzymes are homodimeric and show close homology. [provided by RefSeq, Jul 2008]

Uniprot Description

GOT1: Plays a key role in amino acid metabolism. Belongs to the class-I pyridoxal-phosphate-dependent aminotransferase family.

Protein type: Amino Acid Metabolism - tyrosine; EC 2.6.1.3; Amino Acid Metabolism - cysteine and methionine; EC 2.6.1.1; Amino Acid Metabolism - phenylalanine; Transferase; Amino Acid Metabolism - arginine and proline; Amino Acid Metabolism - phenylalanine, tyrosine and tryptophan biosynthesis; Amino Acid Metabolism - alanine, aspartate and glutamate

Chromosomal Location of Human Ortholog: 10q24.1-q25.1

Cellular Component: cytoplasm; cytosol; mitochondrion; nucleus

Molecular Function: aspartate transaminase activity; cysteine transaminase activity; identical protein binding; pyridoxal phosphate binding

Biological Process: 2-oxoglutarate metabolic process; amino acid biosynthetic process; aspartate biosynthetic process; aspartate catabolic process; aspartate metabolic process; cellular response to insulin stimulus; gluconeogenesis; glutamate metabolic process; glycerol biosynthetic process; response to glucocorticoid stimulus

Disease: Aspartate Aminotransferase, Serum Level Of, Quantitative Trait Locus 1

Research Articles on GOT1

Similar Products

Product Notes

The GOT1 got1 (Catalog #AAA1266580) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcacctc cgtcagtctt tgccgaggtt ccgcaggccc agcctgtcct ggtcttcaag ctcactgccg acttcaggga ggatccggac ccccgcaagg tcaacctggg agtgggagca tatcgcacgg atgactgcca tccctgggtt ttgccagtag tgaagaaagt ggagcagaag attgctaatg acaatagcct aaatcacgag tatctgccaa tcctgggcct ggctgagttc cggagctgtg cttctcgtct tgcccttggg gatgacagcc cagcactcaa ggagaagcgg gtaggaggtg tgcaatcttt ggggggaaca ggtgcacttc gaattggagc tgatttctta gcgcgttggt acaatggaac aaacaacaag aacacacctg tctatgtgtc ctcaccaacc tgggagaatc acaatgctgt gttttccgct gctggtttta aagacattcg gtcctatcgc tactgggatg cagagaagag aggattggac ctccagggct tcctgaatga tctggagaat gctcctgagt tctccattgt tgtcctccac gcctgtgcac acaacccaac tgggattgac ccaactccgg agcagtggaa gcagattgct tctgtcatga agcaccggtt tctgttcccc ttctttgact cagcctatca gggcttcgca tctggaaacc tggagagaga tgcctgggcc attcgctatt ttgtgtctga aggcttcgag ttcttctgtg cccagtcctt ctccaagaac ttcgggctct acaatgagag agtcgggaat ctgactgtgg ttggaaaaga acctgagagc atcctgcaag tcctttccca gatggagaag atcgtgcgga ttacttggtc caatcccccc gcccagggag cacgaattgt ggccagcacc ctctctaacc ctgagctctt tgaggaatgg acaggtaatg tgaagacaat ggctgaccgg attctgacca tgagatctga actcagggca cgactagaag ccctcaaaac ccctgggacc tggaaccaca tcactgatca aattggcatg ttcagcttca ctgggttgaa ccccaagcag gttgagtatc tggtcaatga aaagcacatc tacctgctgc caagtggtcg aatcaacgtg agtggcttaa ccaccaaaaa tctagattac gtggccacct ccatccatga agcagtcacc aaaatccagt ga. It is sometimes possible for the material contained within the vial of "GOT1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.