Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GORASP2 cdna clone

GORASP2 cDNA Clone

Gene Names
GORASP2; p59; GRS2; GOLPH6; GRASP55
Synonyms
GORASP2; GORASP2 cDNA Clone; GORASP2 cdna clone
Ordering
For Research Use Only!
Sequence
atgggctcctcgcaaagcgtcgagatcccgggcgggggcaccgagggctaccacgttctgcgggtacaagaaaattccccaggacacagagctggtttggagcctttctttgattttattgtttctattaatggttcaagattaaataaagacaatgacactcttaaggatctgctgaaagcaaacgttgaaaagcctgtaaagatgcttatctatagcagcaaaacattggaactgcgagagacctcagtcacaccaagtaacctgtggggcggccagggcttattgggagtgagcattcgtttctgcagctttgatggggcaaatgaaaatgtttggcatgtgctggaggtggaatcaaattctcctgcagcactggcaggtcttagaccacacagtgattatataattggagcagatacagtcatgaatgagtctgaagatctattcagccttatcgaaacacatgaagcaaaaccattgaaactgtatgtgtacaacacagacactgataactgtcgagaagtgattattacaccaaattctgcatggggtggagaaggcagcctaggatgtggcattggatatggttatttgcatcgaatacctacacgcccatttgaggaaggaaagaaaatttctcttccaggacaaatggctggtacacctattacacctcttaaagatgggtttacagaggtccagctgtcctcagttaatcccccgtctttgtcaccaccaggaactacaggaattgaacagagtctgactggactttctattagctcaactccaccagctgtcagtagtgttctcagtacaggtgtaccaacagtaccgttattgccaccacaagtaaaccagtccctcacttctgtgccaccaatgaatccagctactacattaccaggtctgatgcctttaccagcaggactgcccaacctccccaacctcaacctcaacctcccagcaccacacatcatgccaggggttggcttaccagaacttgtaaacccaggtctgccacctcttccttccatgcctccccgaaacttacctggcattgcacctctccccctgccatccgagttcctcccgtcattccccttggttccagagagctcttctgcagcaagctcaggagagctgctgtcttccctcccgcccaccagcaacgcaccctctgaccctgccacaactactgcaaaggcagacgctgcctcctcactcactgtggatgtgacgccccccactgccaaggcccccaccaccgttgaggacagagtcggcgactccaccccagtcagcgagaagcctgtttctgcggctgtggatgccaatgcttctgagtcaccttaa
Sequence Length
1359
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
48,674 Da
NCBI Official Full Name
Homo sapiens golgi reassembly stacking protein 2, 55kDa, mRNA
NCBI Official Synonym Full Names
golgi reassembly stacking protein 2
NCBI Official Symbol
GORASP2
NCBI Official Synonym Symbols
p59; GRS2; GOLPH6; GRASP55
NCBI Protein Information
Golgi reassembly-stacking protein 2
UniProt Protein Name
Golgi reassembly-stacking protein 2
UniProt Gene Name
GORASP2
UniProt Synonym Gene Names
GOLPH6; GRS2; GOLPH6; GRASP55
UniProt Entry Name
GORS2_HUMAN

NCBI Description

This gene encodes a member of the Golgi reassembly stacking protein family. These proteins may play a role in the stacking of Golgi cisternae and Golgi ribbon formation, as well as Golgi fragmentation during apoptosis or mitosis. The encoded protein also plays a role in the intracellular transport of transforming growth factor alpha and may function as a molecular chaperone. A pseudogene of this gene is located on the short arm of chromosome 2. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]

Uniprot Description

GRASP55: a golgi reassembly-stacking protein (GRASP) protein involved in the stacking of Golgi cisternae. May be involved in the process by which Golgi stacks reform after mitotic breakdown. May regulate the intracellular transport and presentation of a defined set of transmembrane proteins, such as the TGF-alpha receptor. Oligomerization of its N-terminal GRASP domain regulates the formation of Golgi stacks, a process that is regulated by phosphorylation within the C-terminal Ser/Pro-rich domain. Forms a RAB2 effector complex with BLZF1 in the medial Golgi. Interacts with members of the p24 cargo receptors. Interacts with CNIH and the cytoplasmic domain of the TGF-alpha receptor, prior its transit in the trans-Golgi. Two alternatively spliced isoforms have been described.

Protein type: Motility/polarity/chemotaxis; Vesicle

Chromosomal Location of Human Ortholog: 2q31.1

Cellular Component: Golgi apparatus; Golgi membrane; membrane

Molecular Function: protein binding

Biological Process: organelle organization and biogenesis

Research Articles on GORASP2

Similar Products

Product Notes

The GORASP2 gorasp2 (Catalog #AAA1273915) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggctcct cgcaaagcgt cgagatcccg ggcgggggca ccgagggcta ccacgttctg cgggtacaag aaaattcccc aggacacaga gctggtttgg agcctttctt tgattttatt gtttctatta atggttcaag attaaataaa gacaatgaca ctcttaagga tctgctgaaa gcaaacgttg aaaagcctgt aaagatgctt atctatagca gcaaaacatt ggaactgcga gagacctcag tcacaccaag taacctgtgg ggcggccagg gcttattggg agtgagcatt cgtttctgca gctttgatgg ggcaaatgaa aatgtttggc atgtgctgga ggtggaatca aattctcctg cagcactggc aggtcttaga ccacacagtg attatataat tggagcagat acagtcatga atgagtctga agatctattc agccttatcg aaacacatga agcaaaacca ttgaaactgt atgtgtacaa cacagacact gataactgtc gagaagtgat tattacacca aattctgcat ggggtggaga aggcagccta ggatgtggca ttggatatgg ttatttgcat cgaataccta cacgcccatt tgaggaagga aagaaaattt ctcttccagg acaaatggct ggtacaccta ttacacctct taaagatggg tttacagagg tccagctgtc ctcagttaat cccccgtctt tgtcaccacc aggaactaca ggaattgaac agagtctgac tggactttct attagctcaa ctccaccagc tgtcagtagt gttctcagta caggtgtacc aacagtaccg ttattgccac cacaagtaaa ccagtccctc acttctgtgc caccaatgaa tccagctact acattaccag gtctgatgcc tttaccagca ggactgccca acctccccaa cctcaacctc aacctcccag caccacacat catgccaggg gttggcttac cagaacttgt aaacccaggt ctgccacctc ttccttccat gcctccccga aacttacctg gcattgcacc tctccccctg ccatccgagt tcctcccgtc attccccttg gttccagaga gctcttctgc agcaagctca ggagagctgc tgtcttccct cccgcccacc agcaacgcac cctctgaccc tgccacaact actgcaaagg cagacgctgc ctcctcactc actgtggatg tgacgccccc cactgccaag gcccccacca ccgttgagga cagagtcggc gactccaccc cagtcagcga gaagcctgtt tctgcggctg tggatgccaa tgcttctgag tcaccttaa. It is sometimes possible for the material contained within the vial of "GORASP2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.