Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GOLPH3 cdna clone

GOLPH3 cDNA Clone

Gene Names
GOLPH3; GOPP1; GPP34; MIDAS; Vps74
Synonyms
GOLPH3; GOLPH3 cDNA Clone; GOLPH3 cdna clone
Ordering
For Research Use Only!
Sequence
atgacctcgctgacccagcgcagctccggcctggtgcagcggcgcaccgaggcctcccgcaacgccgccgacaaggagcgggcggcgggcggcggcgccggcagcagcgaggacgacgcgcagagccgccgcgacgagcaggacgacgacgacaagggcgactccaaggaaacgcggctgaccctgatggaggaagtgctcctgctgggcctcaaggaccgcgagggttacacatcattttggaatgactgtatatcatctggattacgtggctgtatgttaattgaattagcattgagaggaaggttacaactagaggcttgtggaatgagacgtaaaagtctattaacaagaaaggtaatctgtaagtcagatgctccaacaggggatgttcttcttgatgaagctctgaagcatgttaaggaaactcagcctccagaaacggtccagaactggattgaattacttagtggtgagacatggaatccattaaaattgcattatcagttaagaaatgtacgggaacgattagctaaaaacctggtggaaaagggtgtattgacaacagagaaacagaacttcctactttttgacatgacaacacatcccctcaccaataacaacattaagcagcgcctcatcaagaaagtacaggaagccgttcttgacaaatgggtgaatgaccctcaccgcatggacaggcgcttgctggccctcatttacctggctcatgcctcggacgtcctggagaatgcttttgctcctcttctggacgagcagtatgatttggctaccaagagagtgcggcagcttctcgacttagaccctgaagtggaatgtctgaaggccaacaccaatgaggttctgtgggcggtggtggcggcgttcaccaagtaa
Sequence Length
897
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
33,811 Da
NCBI Official Full Name
Homo sapiens golgi phosphoprotein 3 (coat-protein), mRNA
NCBI Official Synonym Full Names
golgi phosphoprotein 3
NCBI Official Symbol
GOLPH3
NCBI Official Synonym Symbols
GOPP1; GPP34; MIDAS; Vps74
NCBI Protein Information
Golgi phosphoprotein 3
UniProt Protein Name
Golgi phosphoprotein 3
Protein Family
UniProt Gene Name
GOLPH3
UniProt Synonym Gene Names
GPP34; MIDAS
UniProt Entry Name
GOLP3_HUMAN

NCBI Description

The Golgi complex plays a key role in the sorting and modification of proteins exported from the endoplasmic reticulum. The protein encoded by this gene is a peripheral membrane protein of the Golgi stack and may have a regulatory role in Golgi trafficking. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of these variants has not been determined. [provided by RefSeq, Jul 2008]

Uniprot Description

GOLPH3: Mediates the cis and medial Golgi localization of mannosyltransferases through direct binding of their cytosolic domains. Involved in modulation of mTOR signaling. Involved in the regulation of mitochondrial lipids, leading to increase of mitochondrial mass. Potential oncogene. Belongs to the GOLPH3/VPS74 family.

Protein type: Mitochondrial

Chromosomal Location of Human Ortholog: 5p13.3

Cellular Component: cytosol; Golgi apparatus; Golgi cisterna; intracellular membrane-bound organelle; mitochondrion; nucleoplasm; trans-Golgi network

Molecular Function: enzyme binding; protein binding

Biological Process: cell migration; cell proliferation; gene expression; glycoprotein biosynthetic process; Golgi organization and biogenesis; Golgi to plasma membrane protein transport; Golgi vesicle budding; lamellipodium biogenesis; leukocyte tethering or rolling; negative regulation of apoptosis; positive regulation of protein secretion; positive regulation of TOR signaling pathway; protein retention in Golgi; protein secretion

Research Articles on GOLPH3

Similar Products

Product Notes

The GOLPH3 golph3 (Catalog #AAA1275505) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgacctcgc tgacccagcg cagctccggc ctggtgcagc ggcgcaccga ggcctcccgc aacgccgccg acaaggagcg ggcggcgggc ggcggcgccg gcagcagcga ggacgacgcg cagagccgcc gcgacgagca ggacgacgac gacaagggcg actccaagga aacgcggctg accctgatgg aggaagtgct cctgctgggc ctcaaggacc gcgagggtta cacatcattt tggaatgact gtatatcatc tggattacgt ggctgtatgt taattgaatt agcattgaga ggaaggttac aactagaggc ttgtggaatg agacgtaaaa gtctattaac aagaaaggta atctgtaagt cagatgctcc aacaggggat gttcttcttg atgaagctct gaagcatgtt aaggaaactc agcctccaga aacggtccag aactggattg aattacttag tggtgagaca tggaatccat taaaattgca ttatcagtta agaaatgtac gggaacgatt agctaaaaac ctggtggaaa agggtgtatt gacaacagag aaacagaact tcctactttt tgacatgaca acacatcccc tcaccaataa caacattaag cagcgcctca tcaagaaagt acaggaagcc gttcttgaca aatgggtgaa tgaccctcac cgcatggaca ggcgcttgct ggccctcatt tacctggctc atgcctcgga cgtcctggag aatgcttttg ctcctcttct ggacgagcag tatgatttgg ctaccaagag agtgcggcag cttctcgact tagaccctga agtggaatgt ctgaaggcca acaccaatga ggttctgtgg gcggtggtgg cggcgttcac caagtaa. It is sometimes possible for the material contained within the vial of "GOLPH3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.