Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GNRH1 cdna clone

GNRH1 cDNA Clone

Gene Names
GNRH1; GRH; GNRH; LHRH; LNRH
Synonyms
GNRH1; GNRH1 cDNA Clone; GNRH1 cdna clone
Ordering
For Research Use Only!
Sequence
atgaagccaattcaaaaactcctagctggccttattctactgacttggtgcgtggaaggctgctccagccagcactggtcctatggactgcgccctggaggaaagagagatgccgaaaatttgattgattctttccaagagatagtcaaagaggttggtcaactggcagaaacccaacgcttcgaatgcaccacgcaccagccacgttctcccctccgagacctgaaaggagctctggaaagtctgattgaagaggaaactgggcagaagaagatttaa
Sequence Length
279
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
10,380 Da
NCBI Official Full Name
Homo sapiens gonadotropin-releasing hormone 1 (luteinizing-releasing hormone), mRNA
NCBI Official Synonym Full Names
gonadotropin releasing hormone 1
NCBI Official Symbol
GNRH1
NCBI Official Synonym Symbols
GRH; GNRH; LHRH; LNRH
NCBI Protein Information
progonadoliberin-1
UniProt Protein Name
Progonadoliberin-1
Protein Family
UniProt Gene Name
GNRH1
UniProt Synonym Gene Names
GNRH; GRH; LHRH; GnRH-I; LH-RH I
UniProt Entry Name
GON1_HUMAN

NCBI Description

This gene encodes a preproprotein that is proteolytically processed to generate a peptide that is a member of the gonadotropin-releasing hormone (GnRH) family of peptides. Alternative splicing results in multiple transcript variants, at least one of which is secreted and then cleaved to generate gonadoliberin-1 and GnRH-associated peptide 1. Gonadoliberin-1 stimulates the release of luteinizing and follicle stimulating hormones, which are important for reproduction. Mutations in this gene are associated with hypogonadotropic hypogonadism. [provided by RefSeq, Nov 2015]

Uniprot Description

GNRH1: Stimulates the secretion of gonadotropins; it stimulates the secretion of both luteinizing and follicle-stimulating hormones. Belongs to the GnRH family.

Protein type: Cell cycle regulation; Secreted; Secreted, signal peptide; Hormone

Chromosomal Location of Human Ortholog: 8p21-p11.2

Cellular Component: extracellular region

Molecular Function: hormone activity

Biological Process: cell-cell signaling; multicellular organismal development; negative regulation of cell proliferation; signal transduction

Disease: Hypogonadotropic Hypogonadism 7 With Or Without Anosmia

Research Articles on GNRH1

Similar Products

Product Notes

The GNRH1 gnrh1 (Catalog #AAA1278649) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagccaa ttcaaaaact cctagctggc cttattctac tgacttggtg cgtggaaggc tgctccagcc agcactggtc ctatggactg cgccctggag gaaagagaga tgccgaaaat ttgattgatt ctttccaaga gatagtcaaa gaggttggtc aactggcaga aacccaacgc ttcgaatgca ccacgcacca gccacgttct cccctccgag acctgaaagg agctctggaa agtctgattg aagaggaaac tgggcagaag aagatttaa. It is sometimes possible for the material contained within the vial of "GNRH1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.