Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GNG11 cdna clone

GNG11 cDNA Clone

Gene Names
GNG11; GNGT11
Synonyms
GNG11; GNG11 cDNA Clone; GNG11 cdna clone
Ordering
For Research Use Only!
Sequence
atgcctgcccttcacatcgaagatttgccagagaaggaaaaactgaaaatggaagttgagcagcttcgcaaagaagtgaagttgcagagacaacaagtgtctaaatgttctgaagaaataaagaactatattgaagaacgttctggagaggatcctctagtaaagggaattccagaagacaagaacccctttaaagaaaaaggcagctgtgttatttcataa
Sequence Length
222
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
8,481 Da
NCBI Official Full Name
Homo sapiens guanine nucleotide binding protein (G protein), gamma 11, mRNA
NCBI Official Synonym Full Names
G protein subunit gamma 11
NCBI Official Symbol
GNG11
NCBI Official Synonym Symbols
GNGT11
NCBI Protein Information
guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-11
UniProt Protein Name
Guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-11
UniProt Gene Name
GNG11
UniProt Synonym Gene Names
GNGT11
UniProt Entry Name
GBG11_HUMAN

NCBI Description

This gene is a member of the guanine nucleotide-binding protein (G protein) gamma family and encodes a lipid-anchored, cell membrane protein. As a member of the heterotrimeric G protein complex, this protein plays a role in this transmembrane signaling system. This protein is also subject to carboxyl-terminal processing. Decreased expression of this gene is associated with splenic marginal zone lymphomas. [provided by RefSeq, Jul 2008]

Uniprot Description

G-gamma 11: Guanine nucleotide-binding proteins (G proteins) are involved as a modulator or transducer in various transmembrane signaling systems. The beta and gamma chains are required for the GTPase activity, for replacement of GDP by GTP, and for G protein- effector interaction. Belongs to the G protein gamma family.

Protein type: G protein, heterotrimeric gamma

Chromosomal Location of Human Ortholog: 7q21

Cellular Component: plasma membrane

Molecular Function: GTPase activity

Biological Process: signal transduction

Research Articles on GNG11

Similar Products

Product Notes

The GNG11 gng11 (Catalog #AAA1270812) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcctgccc ttcacatcga agatttgcca gagaaggaaa aactgaaaat ggaagttgag cagcttcgca aagaagtgaa gttgcagaga caacaagtgt ctaaatgttc tgaagaaata aagaactata ttgaagaacg ttctggagag gatcctctag taaagggaat tccagaagac aagaacccct ttaaagaaaa aggcagctgt gttatttcat aa. It is sometimes possible for the material contained within the vial of "GNG11, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.