Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GNB1L cdna clone

GNB1L cDNA Clone

Gene Names
GNB1L; GY2; FKSG1; WDR14; WDVCF; DGCRK3
Synonyms
GNB1L; GNB1L cDNA Clone; GNB1L cdna clone
Ordering
For Research Use Only!
Sequence
atgacggccccctgcccgccgccacctccagacccccagtttgtcctccgaggcacccagtcaccggtgcatgcgctgcacttctgcgaaggagcccaggctcaggggcgcccgctcctcttctcagggtctcagagtggcctggtacacatctggagcctgcagacgcggagagcggttaccaccctggatggccacggcggccagtgtgtgacctggctgcagacgctgccccaggggcgccagctcctcagtcagggccgggacctgaagctgtgcctgtgggacctcgcggagggcaggagcgctgtcgtggactccgtgtgcttggagagtgtgggcttctgccggagcagcatcctggccgggggccagccacgctggacgcttgccgtgccagggaggggcagcgacgaggttcagattctggagatgccctccaagacgtcagtgtgcgccctgaagccgaaggcagatgccaagctgggcatgcccatgtgcctgcggctgtggcaggccgactgcagctcccgcccactccttctggccggctatgaggatggatcggtggtcctgtgggacgtctctgagcagaaggtgtgcagccgcatcgcctgccatgaggagcccgtcatggaccttgactttgactcccagaaggccaggggcatctcaggctccgcggggaaggcgctggctgtctggagcctggactggcagcaggccctgcaggtgcgtgggactcatgaactcaccaatcccgggatcgccgaggtcacgatccggccagatcgcaagatcctggccaccgcaggctgggaccaccgcatccgcgtgttccactggcggacgatgcagccactggccgtgctggccttccacagcgccgctgtccagtgcgtggccttcaccgccgatggcttgctggccgcgggctccaaggatcagcggatcagcctctggtcactctacccacgcgcatga
Sequence Length
984
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
22,896 Da
NCBI Official Full Name
Homo sapiens guanine nucleotide binding protein (G protein), beta polypeptide 1-like, mRNA
NCBI Official Synonym Full Names
G protein subunit beta 1 like
NCBI Official Symbol
GNB1L
NCBI Official Synonym Symbols
GY2; FKSG1; WDR14; WDVCF; DGCRK3
NCBI Protein Information
guanine nucleotide-binding protein subunit beta-like protein 1
UniProt Protein Name
Guanine nucleotide-binding protein subunit beta-like protein 1
UniProt Gene Name
GNB1L
UniProt Synonym Gene Names
GY2; KIAA1645; WDR14; G protein subunit beta-like protein 1; WDVCF
UniProt Entry Name
GNB1L_HUMAN

NCBI Description

This gene encodes a G-protein beta-subunit-like polypeptide which is a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This protein contains 6 WD repeats and is highly expressed in the heart. The gene maps to the region on chromosome 22q11, which is deleted in DiGeorge syndrome, trisomic in derivative 22 syndrome and tetrasomic in cat-eye syndrome. Therefore, this gene may contribute to the etiology of those disorders. Transcripts from this gene share exons with some transcripts from the C22orf29 gene. [provided by RefSeq, Jul 2008]

Uniprot Description

GNB1L: 2 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 22q11.2

Research Articles on GNB1L

Similar Products

Product Notes

The GNB1L gnb1l (Catalog #AAA1276046) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgacggccc cctgcccgcc gccacctcca gacccccagt ttgtcctccg aggcacccag tcaccggtgc atgcgctgca cttctgcgaa ggagcccagg ctcaggggcg cccgctcctc ttctcagggt ctcagagtgg cctggtacac atctggagcc tgcagacgcg gagagcggtt accaccctgg atggccacgg cggccagtgt gtgacctggc tgcagacgct gccccagggg cgccagctcc tcagtcaggg ccgggacctg aagctgtgcc tgtgggacct cgcggagggc aggagcgctg tcgtggactc cgtgtgcttg gagagtgtgg gcttctgccg gagcagcatc ctggccgggg gccagccacg ctggacgctt gccgtgccag ggaggggcag cgacgaggtt cagattctgg agatgccctc caagacgtca gtgtgcgccc tgaagccgaa ggcagatgcc aagctgggca tgcccatgtg cctgcggctg tggcaggccg actgcagctc ccgcccactc cttctggccg gctatgagga tggatcggtg gtcctgtggg acgtctctga gcagaaggtg tgcagccgca tcgcctgcca tgaggagccc gtcatggacc ttgactttga ctcccagaag gccaggggca tctcaggctc cgcggggaag gcgctggctg tctggagcct ggactggcag caggccctgc aggtgcgtgg gactcatgaa ctcaccaatc ccgggatcgc cgaggtcacg atccggccag atcgcaagat cctggccacc gcaggctggg accaccgcat ccgcgtgttc cactggcgga cgatgcagcc actggccgtg ctggccttcc acagcgccgc tgtccagtgc gtggccttca ccgccgatgg cttgctggcc gcgggctcca aggatcagcg gatcagcctc tggtcactct acccacgcgc atga. It is sometimes possible for the material contained within the vial of "GNB1L, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.