GLIPR1L1 cdna clone
GLIPR1L1 cDNA Clone
Gene Names
GLIPR1L1; PRO7434; ALKN2972
Synonyms
GLIPR1L1; GLIPR1L1 cDNA Clone; GLIPR1L1 cdna clone
Sequence
atggctctgaagaataaattcagttgtttatggatcttgggtctgtgtttggtagccactacatcttccaaaatcccatccatcactgacccacactttatagacaactgcatagaagcccacaacgaatggcgtggcaaagtcaaccctcccgcggccgacatgaaatacatgatttgggataaaggtttagcaaagatggctaaagcatgggcaaaccagtgcaaatttgaacataatgactgtttggataaatcatataaatgctatgcagcttttgaatatgttggagaaaatatctggttaggtggaataaagtcattcacaccaagacatgccattacggcttggtataatgaaacccaattttatgattttgatagtctatcatgctccagagtctgtggccattatacacagttagtttgggccaattcattttatgtcggttgtgcagttgcaatgtgtcctaaccttgggggagcttcaactgcaatatttgtatgcaactacggacctgcaggaaattttgcaaatatgcctccttacgtaagaggagaatcttgctctctctgctcaaaagaagagaaatgtgtaaagaacctctgcaaaaatccatttctgaagccaacggggagagcacctcagcagacagcctttaatccattcagcttaggttttcttcttctgagaatcttttaa
Sequence Length
702
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
26,118 Da
NCBI Official Full Name
Homo sapiens GLI pathogenesis-related 1 like 1, mRNA
NCBI Official Synonym Full Names
GLI pathogenesis related 1 like 1
NCBI Official Symbol
GLIPR1L1
NCBI Official Synonym Symbols
PRO7434; ALKN2972
NCBI Protein Information
GLIPR1-like protein 1
UniProt Protein Name
GLIPR1-like protein 1
Protein Family
UniProt Gene Name
GLIPR1L1
UniProt Entry Name
GPRL1_HUMAN
Uniprot Description
GLIPR1L1: Belongs to the CRISP family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Secreted, signal peptide; Secreted
Chromosomal Location of Human Ortholog: 12q21.2
Similar Products
Product Notes
The GLIPR1L1 glipr1l1 (Catalog #AAA1277101) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctctga agaataaatt cagttgttta tggatcttgg gtctgtgttt ggtagccact acatcttcca aaatcccatc catcactgac ccacacttta tagacaactg catagaagcc cacaacgaat ggcgtggcaa agtcaaccct cccgcggccg acatgaaata catgatttgg gataaaggtt tagcaaagat ggctaaagca tgggcaaacc agtgcaaatt tgaacataat gactgtttgg ataaatcata taaatgctat gcagcttttg aatatgttgg agaaaatatc tggttaggtg gaataaagtc attcacacca agacatgcca ttacggcttg gtataatgaa acccaatttt atgattttga tagtctatca tgctccagag tctgtggcca ttatacacag ttagtttggg ccaattcatt ttatgtcggt tgtgcagttg caatgtgtcc taaccttggg ggagcttcaa ctgcaatatt tgtatgcaac tacggacctg caggaaattt tgcaaatatg cctccttacg taagaggaga atcttgctct ctctgctcaa aagaagagaa atgtgtaaag aacctctgca aaaatccatt tctgaagcca acggggagag cacctcagca gacagccttt aatccattca gcttaggttt tcttcttctg agaatctttt aa. It is sometimes possible for the material contained within the vial of "GLIPR1L1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
