Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GLI1 cdna clone

GLI1 cDNA Clone

Gene Names
GLI1; GLI
Synonyms
GLI1; GLI1 cDNA Clone; GLI1 cdna clone
Ordering
For Research Use Only!
Sequence
atgttcaactcgatgaccccaccaccaatcagtagctatggcgagccctgctgtctccggcccctccccagtcagggggcccccagtgtggggacagaaggactgtctggcccgcccttctgccaccaagctaacctcatgtccggcccccacagttatgggccagccagagagaccaacagctgcaccgagggcccactcttttcttctccccggagtgcagtcaagttgaccaagaagcgggcactgtccatctcacctctgtcggatgccagcctggacctgcagacggttatccgcacctcacccagctccctcgtagctttcatcaactcgcgatgcacatctccaggaggctcctacggtcatctctccattggcaccatgagcccatctctgggattcccagcccagatgaatcaccaaaaagggccctcgccttcctttggggtccagccttgtggtccccatgactctgcccggggtgggatgatcccacatcctcagtcccggggacccttcccaacttgccagctgaagtctgagctggacatgctggttggcaagtgccgggaggaacccttggaaggtgatatgtccagccccaactccacaggcatacaggatcccctgttggggatgctggatgggcgggaggacctcgagagagaggagaagcgtgagcctgaatctgtgtatgaaactgactgccgttgggatggctgcagccaggaatttgactcccaagagcagctggtgcaccacatcaacagcgagcacatccacggggagcggaaggagttcgtgtgccactgggggggctgctccagggagctgaggcccttcaaagcccagtacatgctggtggttcacatgcgcagacacactggcgagaagccacacaagtgcacgtttgaagggtgccggaagtcatactcacgcctcgaaaacctgaagacgcacctgcggtcacacacgggtgagaagccatacatgtgtgagcacgagggctgcagtaaagccttcagcaatgccagtgaccgagccaagcaccagaatcggacccattccaatgagaagccgtatgtatgtaagctccctggctgcaccaaacgctatacagatcctagctcgctgcgaaaacatgtcaagacagtgcatggtcctgacgcccatgtgaccaaacggcaccgtggggatggccccctgcctcgggcaccatccatttctacagtggagcccaagagggagcgggaaggaggtcccatcagggaggaaagcagactgactgtgccagagggtgccatgaagccacagccaagccctggggcccagtcatcctgcagcagtgaccactccccggcagggagtgcagccaatacagacagtggtgtggaaatgactggcaatgcagggggcagcactgaagacctctccagcttggacgagggaccttgcattgctggcactggtctgtccactcttcgccgccttgagaacctcaggctggaccagctacatcaactccggccaatagggacccggggtctcaaactgcccagcttgtcccacaccggtaccactgtgtcccgccgcgtgggccccccagtctctcttgaacgccgcagcagcagctccagcagcatcagctctgcctatactgtcagccgccgctcctccctggcctctcctttcccccctggctccccaccagagaatggagcatcctccctgcctggccttatgcctgcccagcactacctgcttcgggcaagatatgcttcagccagagggggtggtacttcgcccactgcagcatccagcctggatcggataggtggtcttcccatgcctccttggagaagccgagccgagtatccaggatacaaccccaatgcaggggtcacccggagggccagtgacccagcccaggctgctgaccgtcctgctccagctagagtccagaggttcaagagcctgggctgtgtccataccccacccactgtggcagggggaggacagaactttgatccttacctcccaacctctgtctactcaccacagccccccagcatcactgagaatgctgccatggatgctagagggctacaggaagagccagaagttgggacctccatggtgggcagtggtctgaacccctatatggacttcccacctactgatactctgggatatgggggacctgaaggggcagcagctgagccttatggagcgaggggtccaggctctctgcctcttgggcctggtccacccaccaactatggccccaacccctgtccccagcaggcctcatatcctgaccccacccaagaaacatggggtgagttcccttcccactctgggctgtacccaggccccaaggctctaggtggaacctacagccagtgtcctcgacttgaacattatggacaagtgcaagtcaagccagaacaggggtgcccagtggggtctgactccacaggactggcaccctgcctcaatgcccaccccagtgaggggcccccacatccacagcctctcttttcccattacccccagccctctcctccccaatatctccagtcaggcccctatacccagccaccccctgattatcttccttcagaacccaggccttgcctggactttgattcccccacccattccacagggcagctcaaggctcagcttgtgtgtaattatgttcaatctcaacaggagctactgtgggagggtgggggcagggaagatgcccccgcccaggaaccttcctaccagagtcccaagtttctggggggttcccaggttagcccaagccgtgctaaagctccagtgaacacatatggacctggctttggacccaacttgcccaatcacaagtcaggttcctatcccaccccttcaccatgccatgaaaattttgtagtgggggcaaatagggcttcacatagggcagcagcaccacctcgacttctgcccccattgcccacttgctatgggcctctcaaagtgggaggcacaaaccccagctgtggtcatcctgaggtgggcaggctaggagggggtcctgccttgtaccctcctcccgaaggacaggtatgtaaccccctggactctcttgatcttgacaacactcagctggactttgtggctattctggatgagccccaggggctgagtcctcctccttcccatgatcagcggggcagctctggacataccccacctccctctgggccccccaacatggctgtgggcaacatgagtgtcttactgagatccctacctggggaaacagaattcctcaactctagtgcctaa
Sequence Length
3321
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
104,627 Da
NCBI Official Full Name
Homo sapiens GLI family zinc finger 1, mRNA
NCBI Official Synonym Full Names
GLI family zinc finger 1
NCBI Official Symbol
GLI1
NCBI Official Synonym Symbols
GLI
NCBI Protein Information
zinc finger protein GLI1
UniProt Protein Name
Zinc finger protein GLI1
Protein Family
UniProt Gene Name
GLI1
UniProt Synonym Gene Names
GLI
UniProt Entry Name
GLI1_HUMAN

NCBI Description

This gene encodes a member of the Kruppel family of zinc finger proteins. The encoded transcription factor is activated by the sonic hedgehog signal transduction cascade and regulates stem cell proliferation. The activity and nuclear localization of this protein is negatively regulated by p53 in an inhibitory loop. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]

Uniprot Description

GLI1: Acts as a transcriptional activator. May regulate the transcription of specific genes during normal development. May play a role in craniofacial development and digital development, as well as development of the central nervous system and gastrointestinal tract. Mediates SHH signaling and thus cell proliferation and differentiation. Interacts with KIF7. Interacts with ZIC1; the interaction enhances transcription activation. Amplified in glioblastoma cells. Testis, myometrium and fallopian tube. Also expressed in the brain with highest expression in the cerebellum, optic nerve and olfactory tract. Belongs to the GLI C2H2-type zinc-finger protein family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Transcription factor; C2H2-type zinc finger protein; Oncoprotein

Chromosomal Location of Human Ortholog: 12q13.2-q13.3

Cellular Component: cytoplasm; cytosol; intracellular membrane-bound organelle; nucleoplasm; nucleus

Molecular Function: DNA binding; protein binding

Biological Process: digestive tract morphogenesis; epidermal cell differentiation; osteoblast differentiation; positive regulation of cell proliferation; positive regulation of DNA replication; positive regulation of smoothened signaling pathway; positive regulation of transcription from RNA polymerase II promoter; positive regulation of transcription, DNA-dependent; regulation of smoothened signaling pathway; smoothened signaling pathway

Research Articles on GLI1

Similar Products

Product Notes

The GLI1 gli1 (Catalog #AAA1271307) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttcaact cgatgacccc accaccaatc agtagctatg gcgagccctg ctgtctccgg cccctcccca gtcagggggc ccccagtgtg gggacagaag gactgtctgg cccgcccttc tgccaccaag ctaacctcat gtccggcccc cacagttatg ggccagccag agagaccaac agctgcaccg agggcccact cttttcttct ccccggagtg cagtcaagtt gaccaagaag cgggcactgt ccatctcacc tctgtcggat gccagcctgg acctgcagac ggttatccgc acctcaccca gctccctcgt agctttcatc aactcgcgat gcacatctcc aggaggctcc tacggtcatc tctccattgg caccatgagc ccatctctgg gattcccagc ccagatgaat caccaaaaag ggccctcgcc ttcctttggg gtccagcctt gtggtcccca tgactctgcc cggggtggga tgatcccaca tcctcagtcc cggggaccct tcccaacttg ccagctgaag tctgagctgg acatgctggt tggcaagtgc cgggaggaac ccttggaagg tgatatgtcc agccccaact ccacaggcat acaggatccc ctgttgggga tgctggatgg gcgggaggac ctcgagagag aggagaagcg tgagcctgaa tctgtgtatg aaactgactg ccgttgggat ggctgcagcc aggaatttga ctcccaagag cagctggtgc accacatcaa cagcgagcac atccacgggg agcggaagga gttcgtgtgc cactgggggg gctgctccag ggagctgagg cccttcaaag cccagtacat gctggtggtt cacatgcgca gacacactgg cgagaagcca cacaagtgca cgtttgaagg gtgccggaag tcatactcac gcctcgaaaa cctgaagacg cacctgcggt cacacacggg tgagaagcca tacatgtgtg agcacgaggg ctgcagtaaa gccttcagca atgccagtga ccgagccaag caccagaatc ggacccattc caatgagaag ccgtatgtat gtaagctccc tggctgcacc aaacgctata cagatcctag ctcgctgcga aaacatgtca agacagtgca tggtcctgac gcccatgtga ccaaacggca ccgtggggat ggccccctgc ctcgggcacc atccatttct acagtggagc ccaagaggga gcgggaagga ggtcccatca gggaggaaag cagactgact gtgccagagg gtgccatgaa gccacagcca agccctgggg cccagtcatc ctgcagcagt gaccactccc cggcagggag tgcagccaat acagacagtg gtgtggaaat gactggcaat gcagggggca gcactgaaga cctctccagc ttggacgagg gaccttgcat tgctggcact ggtctgtcca ctcttcgccg ccttgagaac ctcaggctgg accagctaca tcaactccgg ccaataggga cccggggtct caaactgccc agcttgtccc acaccggtac cactgtgtcc cgccgcgtgg gccccccagt ctctcttgaa cgccgcagca gcagctccag cagcatcagc tctgcctata ctgtcagccg ccgctcctcc ctggcctctc ctttcccccc tggctcccca ccagagaatg gagcatcctc cctgcctggc cttatgcctg cccagcacta cctgcttcgg gcaagatatg cttcagccag agggggtggt acttcgccca ctgcagcatc cagcctggat cggataggtg gtcttcccat gcctccttgg agaagccgag ccgagtatcc aggatacaac cccaatgcag gggtcacccg gagggccagt gacccagccc aggctgctga ccgtcctgct ccagctagag tccagaggtt caagagcctg ggctgtgtcc ataccccacc cactgtggca gggggaggac agaactttga tccttacctc ccaacctctg tctactcacc acagcccccc agcatcactg agaatgctgc catggatgct agagggctac aggaagagcc agaagttggg acctccatgg tgggcagtgg tctgaacccc tatatggact tcccacctac tgatactctg ggatatgggg gacctgaagg ggcagcagct gagccttatg gagcgagggg tccaggctct ctgcctcttg ggcctggtcc acccaccaac tatggcccca acccctgtcc ccagcaggcc tcatatcctg accccaccca agaaacatgg ggtgagttcc cttcccactc tgggctgtac ccaggcccca aggctctagg tggaacctac agccagtgtc ctcgacttga acattatgga caagtgcaag tcaagccaga acaggggtgc ccagtggggt ctgactccac aggactggca ccctgcctca atgcccaccc cagtgagggg cccccacatc cacagcctct cttttcccat tacccccagc cctctcctcc ccaatatctc cagtcaggcc cctataccca gccaccccct gattatcttc cttcagaacc caggccttgc ctggactttg attcccccac ccattccaca gggcagctca aggctcagct tgtgtgtaat tatgttcaat ctcaacagga gctactgtgg gagggtgggg gcagggaaga tgcccccgcc caggaacctt cctaccagag tcccaagttt ctggggggtt cccaggttag cccaagccgt gctaaagctc cagtgaacac atatggacct ggctttggac ccaacttgcc caatcacaag tcaggttcct atcccacccc ttcaccatgc catgaaaatt ttgtagtggg ggcaaatagg gcttcacata gggcagcagc accacctcga cttctgcccc cattgcccac ttgctatggg cctctcaaag tgggaggcac aaaccccagc tgtggtcatc ctgaggtggg caggctagga gggggtcctg ccttgtaccc tcctcccgaa ggacaggtat gtaaccccct ggactctctt gatcttgaca acactcagct ggactttgtg gctattctgg atgagcccca ggggctgagt cctcctcctt cccatgatca gcggggcagc tctggacata ccccacctcc ctctgggccc cccaacatgg ctgtgggcaa catgagtgtc ttactgagat ccctacctgg ggaaacagaa ttcctcaact ctagtgccta a. It is sometimes possible for the material contained within the vial of "GLI1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.