Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GK cdna clone

GK cDNA Clone

Gene Names
GK; GK1; GKD
Synonyms
GK; GK cDNA Clone; GK cdna clone
Ordering
For Research Use Only!
Sequence
atggcagcctcaaagaaggcagttttggggccattggtgggggcggtggaccagggcaccagttcgacgcgctttttggttttcaattcaaaaacagctgaactacttagtcatcatcaagtagaaataaaacaagagttcccaagagaaggatgggtggaacaggaccctaaggaaattctacattctgtctatgagtgtatagagaaaacatgtgagaaacttggacagctcaaaattgatatttccaacataaaagctattggtgtcagcaaccagagggaaaccactgtagtctgggacaagataactggagagcctctctacaatgctgtggtgtggcttgatctaagaacccagtctaccgttgagagtcttagtaaaagaattacaggaaataataactttgtcaagtccaagacaggccttccacttagcacttacttcagtgcagtgaaacttcgttggctccttgacaatgtgagaaaagttcaaaaggcagttgaagaaaaacgagctctttttgggactattgattcatggcttatttggagtttgacaggaggagtcaatggaggtgtccactgtacagatgtaacaaatgcaagtaggactatgcttttcaacattcattctttggaatgggataaacaactctgcgaattttttggaattccaatggaaattcttccaaatgtccggagttcttctgagatctatggcctaatgaaaatctctcatagcgtgaaagctggggccttggaaggtgtgccaatatctgggtgtttaggggaccagtctgctgcattggtgggacaaatgtgcttccagattggacaagccaaaaatacgtatggaacaggatgtttcttactatgtaatacaggccataagtgtgtattttctgatcatggccttctcaccacagtggcttacaaacttggcagagacaaaccagtatattatgctttggaaggttctgtagctatagctggtgctgttattcgctggctaagagacaatcttggaattataaagacctcagaagaaattgaaaaacttgctaaagaagtaggtacttcttatggctgctacttcgtcccagcattttcggggttatatgcaccttattgggagcccagcgcaagagggataatctgtggactcactcagttcaccaataaatgccatattgcttttgctgcattagaagctgtttgtttccaaactcgagagattttggatgccatgaatcgagactgtggaattccactcagtcatttgcaggtagatggaggaatgaccagcaacaaaattcttatgcagctacaagcagacattctgtatataccagtagtgaagccctcaatgcccgaaaccactgcactgggtgcggctatggcggcaggggctgcagaaggagtcggcgtatggagtctcgaacccgaggatttgtctgccgtcacgatggagcggtttgaacctcagattaatgcggaggaaagtgaaattcgttattctacatggaagaaagctgtgatgaagtcaatgggttgggttacaactcaatctccagaaagtggtattccataa
Sequence Length
1593
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
58,141 Da
NCBI Official Full Name
Homo sapiens glycerol kinase, mRNA
NCBI Official Synonym Full Names
glycerol kinase
NCBI Official Symbol
GK
NCBI Official Synonym Symbols
GK1; GKD
NCBI Protein Information
glycerol kinase
UniProt Protein Name
Glycerol kinase
Protein Family
UniProt Gene Name
GK
UniProt Synonym Gene Names
GK; Glycerokinase
UniProt Entry Name
GLPK_HUMAN

NCBI Description

The protein encoded by this gene belongs to the FGGY kinase family. This protein is a key enzyme in the regulation of glycerol uptake and metabolism. It catalyzes the phosphorylation of glycerol by ATP, yielding ADP and glycerol-3-phosphate. Mutations in this gene are associated with glycerol kinase deficiency (GKD). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]

Uniprot Description

GLPK: Key enzyme in the regulation of glycerol uptake and metabolism. Defects in GK are the cause of GK deficiency (GKD). This disease can be either symptomatic with episodic metabolic and CNS decompensation or asymptomatic with hyperglycerolemia and hyperglyceroluria only. Belongs to the FGGY kinase family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Lipid Metabolism - glycerolipid; Kinase, other; EC 2.7.1.30; Mitochondrial

Chromosomal Location of Human Ortholog: Xp21.3

Cellular Component: cytosol; mitochondrion

Molecular Function: glycerol kinase activity; protein binding

Biological Process: glycerol metabolic process; glycerol-3-phosphate biosynthetic process; triacylglycerol biosynthetic process; triacylglycerol metabolic process

Disease: Glycerol Kinase Deficiency

Research Articles on GK

Similar Products

Product Notes

The GK gk (Catalog #AAA1269389) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcagcct caaagaaggc agttttgggg ccattggtgg gggcggtgga ccagggcacc agttcgacgc gctttttggt tttcaattca aaaacagctg aactacttag tcatcatcaa gtagaaataa aacaagagtt cccaagagaa ggatgggtgg aacaggaccc taaggaaatt ctacattctg tctatgagtg tatagagaaa acatgtgaga aacttggaca gctcaaaatt gatatttcca acataaaagc tattggtgtc agcaaccaga gggaaaccac tgtagtctgg gacaagataa ctggagagcc tctctacaat gctgtggtgt ggcttgatct aagaacccag tctaccgttg agagtcttag taaaagaatt acaggaaata ataactttgt caagtccaag acaggccttc cacttagcac ttacttcagt gcagtgaaac ttcgttggct ccttgacaat gtgagaaaag ttcaaaaggc agttgaagaa aaacgagctc tttttgggac tattgattca tggcttattt ggagtttgac aggaggagtc aatggaggtg tccactgtac agatgtaaca aatgcaagta ggactatgct tttcaacatt cattctttgg aatgggataa acaactctgc gaattttttg gaattccaat ggaaattctt ccaaatgtcc ggagttcttc tgagatctat ggcctaatga aaatctctca tagcgtgaaa gctggggcct tggaaggtgt gccaatatct gggtgtttag gggaccagtc tgctgcattg gtgggacaaa tgtgcttcca gattggacaa gccaaaaata cgtatggaac aggatgtttc ttactatgta atacaggcca taagtgtgta ttttctgatc atggccttct caccacagtg gcttacaaac ttggcagaga caaaccagta tattatgctt tggaaggttc tgtagctata gctggtgctg ttattcgctg gctaagagac aatcttggaa ttataaagac ctcagaagaa attgaaaaac ttgctaaaga agtaggtact tcttatggct gctacttcgt cccagcattt tcggggttat atgcacctta ttgggagccc agcgcaagag ggataatctg tggactcact cagttcacca ataaatgcca tattgctttt gctgcattag aagctgtttg tttccaaact cgagagattt tggatgccat gaatcgagac tgtggaattc cactcagtca tttgcaggta gatggaggaa tgaccagcaa caaaattctt atgcagctac aagcagacat tctgtatata ccagtagtga agccctcaat gcccgaaacc actgcactgg gtgcggctat ggcggcaggg gctgcagaag gagtcggcgt atggagtctc gaacccgagg atttgtctgc cgtcacgatg gagcggtttg aacctcagat taatgcggag gaaagtgaaa ttcgttattc tacatggaag aaagctgtga tgaagtcaat gggttgggtt acaactcaat ctccagaaag tggtattcca taa. It is sometimes possible for the material contained within the vial of "GK, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.