Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GHRH cdna clone

GHRH cDNA Clone

Gene Names
GHRH; GRF; INN; GHRF
Synonyms
GHRH; GHRH cDNA Clone; GHRH cdna clone
Ordering
For Research Use Only!
Sequence
ATGCCACTCTGGGTGTTCTTCTTTGTGATCCTCACCCTCAGCAACAGCTCCCACTGCTCCCCACCTCCCCCTTTGACCCTCAGGATGCGGCGGTATGCAGATGCCATCTTCACCAACAGCTACCGGAAGGTGCTGGGCCAGCTGTCCGCCCGCAAGCTGCTCCAGGACATCATGAGCAGGCAGCAGGGAGAGAGCAACCAAGAGCGAGGAGCAAGGGCACGGCTTGGTCGTCAGGTAGACAGCATGTGGGCAGAACAAAAGCAAATGGAATTGGAGAGCATCCTGGTGGCCCTGCTGCAGAAGCACAGGAACTCCCAGGGATGA
Sequence Length
324
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
12,360 Da
NCBI Official Full Name
Homo sapiens growth hormone releasing hormone, mRNA
NCBI Official Synonym Full Names
growth hormone releasing hormone
NCBI Official Symbol
GHRH
NCBI Official Synonym Symbols
GRF; INN; GHRF
NCBI Protein Information
somatoliberin
UniProt Protein Name
Somatoliberin
Protein Family
UniProt Gene Name
GHRH
UniProt Synonym Gene Names
GHRF; GRF; GHRH
UniProt Entry Name
SLIB_HUMAN

NCBI Description

This gene encodes a member of the glucagon family of proteins. The encoded preproprotein is produced in the hypothalamus and cleaved to generate the mature factor, known as somatoliberin, which acts to stimulate growth hormone release from the pituitary gland. Variant receptors for somatoliberin have been found in several types of tumors, and antagonists of these receptors can inhibit the growth of the tumors. Defects in this gene are a cause of dwarfism, while hypersecretion of the encoded protein is a cause of gigantism. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed. [provided by RefSeq, Jan 2016]

Uniprot Description

GHRH: GRF is released by the hypothalamus and acts on the adenohypophyse to stimulate the secretion of growth hormone. Belongs to the glucagon family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Secreted; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 20q11.2

Cellular Component: extracellular region; extracellular space; terminal button

Molecular Function: growth hormone-releasing hormone activity; growth hormone-releasing hormone receptor binding

Biological Process: adenohypophysis development; cAMP-mediated signaling; cell-cell signaling; G-protein signaling, adenylate cyclase activating pathway; growth hormone secretion; positive regulation of cAMP biosynthetic process; positive regulation of cell proliferation; positive regulation of circadian sleep/wake cycle, REM sleep; positive regulation of growth hormone secretion; positive regulation of multicellular organism growth; response to food

Research Articles on GHRH

Similar Products

Product Notes

The GHRH ghrh (Catalog #AAA1269071) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGCCACTCT GGGTGTTCTT CTTTGTGATC CTCACCCTCA GCAACAGCTC CCACTGCTCC CCACCTCCCC CTTTGACCCT CAGGATGCGG CGGTATGCAG ATGCCATCTT CACCAACAGC TACCGGAAGG TGCTGGGCCA GCTGTCCGCC CGCAAGCTGC TCCAGGACAT CATGAGCAGG CAGCAGGGAG AGAGCAACCA AGAGCGAGGA GCAAGGGCAC GGCTTGGTCG TCAGGTAGAC AGCATGTGGG CAGAACAAAA GCAAATGGAA TTGGAGAGCA TCCTGGTGGC CCTGCTGCAG AAGCACAGGA ACTCCCAGGG ATGA. It is sometimes possible for the material contained within the vial of "GHRH, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.