Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GCSH cdna clone

GCSH cDNA Clone

Gene Names
GCSH; GCE; NKH
Synonyms
GCSH; GCSH cDNA Clone; GCSH cdna clone
Ordering
For Research Use Only!
Sequence
atggcgctgcgagtggtgcggagcgtgcgggccctgctctgcaccctgcgcgcggtcccgttacccgccgcgccctgcccgccgaggccctggcagctgggggtgggcgccgtccgtacgctgcgcactggacccgctctgctctcggtgcgtaaattcacagagaaacacgaatgggtaacaacagaaaatggcattggaacagtgggaatcagcaattttgcacaggaagcgttgggagatgttgtttattgtagtctccctgaagttgggacaaaattgaacaaacaagactag
Sequence Length
297
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
18,885 Da
NCBI Official Full Name
Homo sapiens glycine cleavage system protein H (aminomethyl carrier), mRNA
NCBI Official Synonym Full Names
glycine cleavage system protein H
NCBI Official Symbol
GCSH
NCBI Official Synonym Symbols
GCE; NKH
NCBI Protein Information
glycine cleavage system H protein, mitochondrial
UniProt Protein Name
Glycine cleavage system H protein, mitochondrial
UniProt Gene Name
GCSH
UniProt Entry Name
GCSH_HUMAN

NCBI Description

Degradation of glycine is brought about by the glycine cleavage system, which is composed of four mitochondrial protein components: P protein (a pyridoxal phosphate-dependent glycine decarboxylase), H protein (a lipoic acid-containing protein), T protein (a tetrahydrofolate-requiring enzyme), and L protein (a lipoamide dehydrogenase). The protein encoded by this gene is the H protein, which transfers the methylamine group of glycine from the P protein to the T protein. Defects in this gene are a cause of nonketotic hyperglycinemia (NKH). Two transcript variants, one protein-coding and the other probably not protein-coding,have been found for this gene. Also, several transcribed and non-transcribed pseudogenes of this gene exist throughout the genome.[provided by RefSeq, Jan 2010]

Uniprot Description

GCSH: The glycine cleavage system catalyzes the degradation of glycine. The H protein shuttles the methylamine group of glycine from the P protein to the T protein. Defects in GCSH are a cause of non-ketotic hyperglycinemia (NKH); also known as glycine encephalopathy (GCE). NKH is an autosomal recessive disease characterized by accumulation of a large amount of glycine in body fluid and by severe neurological symptoms. Belongs to the GcvH family.

Chromosomal Location of Human Ortholog: 16q23.2

Cellular Component: mitochondrial matrix; mitochondrion

Molecular Function: aminomethyltransferase activity

Biological Process: glycine catabolic process; glyoxylate metabolic process

Disease: Glycine Encephalopathy

Research Articles on GCSH

Similar Products

Product Notes

The GCSH gcsh (Catalog #AAA1277611) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgctgc gagtggtgcg gagcgtgcgg gccctgctct gcaccctgcg cgcggtcccg ttacccgccg cgccctgccc gccgaggccc tggcagctgg gggtgggcgc cgtccgtacg ctgcgcactg gacccgctct gctctcggtg cgtaaattca cagagaaaca cgaatgggta acaacagaaa atggcattgg aacagtggga atcagcaatt ttgcacagga agcgttggga gatgttgttt attgtagtct ccctgaagtt gggacaaaat tgaacaaaca agactag. It is sometimes possible for the material contained within the vial of "GCSH, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.