Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GCM2 cdna clone

GCM2 cDNA Clone

Gene Names
GCM2; GCMB; hGCMb
Synonyms
GCM2; GCM2 cDNA Clone; GCM2 cdna clone
Ordering
For Research Use Only!
Sequence
atgccggcggccgcggtgcaggaagcggtcggcgtgtgctcctacgggatgcagctcagctgggacatcaacgatccgcagatgcctcaggagctggccctctttgaccaattccgagagtggcctgacggctatgtgcgcttcatctacagcagcgatgagaagaaggcacagcgtcacctgagcggctgggccatgcgcaacaccaacaaccacaatggccacatcctcaagaagtcgtgcctgggtgtggtggtgtgtacacaggcctgcaccctgcccgacggttcccgcctgcagctgaggccggccatctgcgacaaggcacggctgaaacagcagaagaaggcatgccctaactgtcattctgctttggagttgattccttgtcgagggcacagcggataccccgtaaccaacttttggcggcttgatggcaacgcgatcttttttcaggccaagggagttcatgatcatccaagaccagagagcaaatcagagacagaagctagaagaagcgccatcaagagacaaatggcctctttctaccaaccccagaaaaagagaattcgagaatccgaggcagaagaaaatcaagacagcagtggtcatttcagcaacatacctcccttggaaaatccagaagactttgatatagttactgaaaccagcttccctattccagggcagccttgcccttccttcccaaagtctgatgtttacaaagctacctgtgacctagccacctttcaaggagacaaaatgccacccttccagaaatactcaagcccaagaatctatttgcctaggccaccttgcagctatgaattggcaaaccctggttatacaaattcaagcccatatcccaccctttataaggattccaccagtatccctaatgacacagactgggttcatctgaacacactacaatgtaatgtcaattcatacagcagctatgagagaagctttgatttcaccaacaaacagcatggctggaaaccagctcttggaaaacccagccttgtggaaaggactaaccatgggcagtttcaggccatggccactcgcccttattataacccagagcttccctgcaggtacctcacgactccaccaccaggtgcccctgccctacaaaccgtgatcaccaccaccactaaagtgtcctaccaggcctaccagccccctgctatgaaatacagtgacagtgtgcgagaggtgaagagcctttcgagctgtaactatgctcctgaagatactgggatgtctgtctatccagaaccctggggtcctccggtgacagtcaccagggcagcctctccttcagggccacctcctatgaaaattgcaggagattgccgggccatcagacccactgtggctattccccacgagccagtttcctctaggacagatgaagcagagacttgggatgtgtgtctgtctgggctgggctccgcagtcagttactcagacagagtgggtcccttctttacctacaacaatgaggatttttga
Sequence Length
1521
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
56,610 Da
NCBI Official Full Name
Homo sapiens glial cells missing homolog 2 (Drosophila), mRNA
NCBI Official Synonym Full Names
glial cells missing homolog 2
NCBI Official Symbol
GCM2
NCBI Official Synonym Symbols
GCMB; hGCMb
NCBI Protein Information
chorion-specific transcription factor GCMb
UniProt Protein Name
Chorion-specific transcription factor GCMb
UniProt Gene Name
GCM2
UniProt Synonym Gene Names
GCMB; hGCMb
UniProt Entry Name
GCM2_HUMAN

NCBI Description

This gene is a homolog of the Drosophila glial cells missing gene, which is thought to act as a binary switch between neuronal and glial cell determination. The protein encoded by this gene contains a conserved N-terminal GCM motif that has DNA-binding activity. The protein is a transcription factor that acts as a master regulator of parathyroid development. It has been suggested that this transcription factor might mediate the effect of calcium on parathyroid hormone expression and secretion in parathyroid cells. Mutations in this gene are associated with hypoparathyroidism. [provided by RefSeq, Jul 2008]

Uniprot Description

GCM2: Probable transcriptional regulator. Defects in GCM2 are a cause of familial isolated hypoparathyroidism (FIH); also known as autosomal dominant hypoparathyroidism or autosomal dominant hypocalcemia. FIH is characterized by hypocalcemia and hyperphosphatemia due to inadequate secretion of parathyroid hormone. Symptoms are seizures, tetany and cramps. An autosomal recessive form of FIH also exists.

Protein type: DNA-binding; Transcription factor

Chromosomal Location of Human Ortholog: 6p23

Cellular Component: nucleus

Molecular Function: DNA binding; protein binding; sequence-specific DNA binding

Biological Process: cellular calcium ion homeostasis; cellular phosphate ion homeostasis; gliogenesis; parathyroid gland development

Disease: Hypoparathyroidism, Familial Isolated

Research Articles on GCM2

Similar Products

Product Notes

The GCM2 gcm2 (Catalog #AAA1275555) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccggcgg ccgcggtgca ggaagcggtc ggcgtgtgct cctacgggat gcagctcagc tgggacatca acgatccgca gatgcctcag gagctggccc tctttgacca attccgagag tggcctgacg gctatgtgcg cttcatctac agcagcgatg agaagaaggc acagcgtcac ctgagcggct gggccatgcg caacaccaac aaccacaatg gccacatcct caagaagtcg tgcctgggtg tggtggtgtg tacacaggcc tgcaccctgc ccgacggttc ccgcctgcag ctgaggccgg ccatctgcga caaggcacgg ctgaaacagc agaagaaggc atgccctaac tgtcattctg ctttggagtt gattccttgt cgagggcaca gcggataccc cgtaaccaac ttttggcggc ttgatggcaa cgcgatcttt tttcaggcca agggagttca tgatcatcca agaccagaga gcaaatcaga gacagaagct agaagaagcg ccatcaagag acaaatggcc tctttctacc aaccccagaa aaagagaatt cgagaatccg aggcagaaga aaatcaagac agcagtggtc atttcagcaa catacctccc ttggaaaatc cagaagactt tgatatagtt actgaaacca gcttccctat tccagggcag ccttgccctt ccttcccaaa gtctgatgtt tacaaagcta cctgtgacct agccaccttt caaggagaca aaatgccacc cttccagaaa tactcaagcc caagaatcta tttgcctagg ccaccttgca gctatgaatt ggcaaaccct ggttatacaa attcaagccc atatcccacc ctttataagg attccaccag tatccctaat gacacagact gggttcatct gaacacacta caatgtaatg tcaattcata cagcagctat gagagaagct ttgatttcac caacaaacag catggctgga aaccagctct tggaaaaccc agccttgtgg aaaggactaa ccatgggcag tttcaggcca tggccactcg cccttattat aacccagagc ttccctgcag gtacctcacg actccaccac caggtgcccc tgccctacaa accgtgatca ccaccaccac taaagtgtcc taccaggcct accagccccc tgctatgaaa tacagtgaca gtgtgcgaga ggtgaagagc ctttcgagct gtaactatgc tcctgaagat actgggatgt ctgtctatcc agaaccctgg ggtcctccgg tgacagtcac cagggcagcc tctccttcag ggccacctcc tatgaaaatt gcaggagatt gccgggccat cagacccact gtggctattc cccacgagcc agtttcctct aggacagatg aagcagagac ttgggatgtg tgtctgtctg ggctgggctc cgcagtcagt tactcagaca gagtgggtcc cttctttacc tacaacaatg aggatttttg a. It is sometimes possible for the material contained within the vial of "GCM2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.