Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GCLM cdna clone

GCLM cDNA Clone

Gene Names
GCLM; GLCLR
Synonyms
GCLM; GCLM cDNA Clone; GCLM cdna clone
Ordering
For Research Use Only!
Sequence
atgggcaccgacagccgcgcggccaaggcgctcctggcgcgggcccgcaccctgcacctgcagacggggaacctgctgaactggggccgcctgcggaagaagtgcccgtccacgcacagcgaggagcttcatgattgtatccaaaaaaccttgaatgaatggagttcccaaatcaacccagatttggtcagggagtttccagatgtcttggaatgcactgtatctcatgcagtagaaaagataaatcctgatgaaagagaagaaatgaaagtttctgcaaaactgttcattgtagaatcaaactcttcatcatcaactagaagtgcagttgacatggcctgttcagtccttggagttgcacagctggattctgtgatcattgcttcacctcctattgaagatggagttaatctttccttggagcatttacagccttactgggaggaattagaaaacttagttcagagcaaaaagattgttgccataggtacctctgatctagacaaaacacagttggaacagctgtatcagtgggcacaggtaaaaccaaatagtaaccaagttaatcttgcctcctgctgtgtgatgccaccagatttgactgcatttgctaaacaatttgacatacagctgttgactcacaatgatccaaaagaactgctttctgaagcaagtttccaagaagctcttcaggaaagcattcctgacattcaagcgcacgagtgggtgccgctgtggctactgcggtattcggtcattgtgaaaagtagaggaattatcaaatcaaaaggctacattttacaagctaaaagaaggggttcttaa
Sequence Length
825
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
28,135 Da
NCBI Official Full Name
Homo sapiens glutamate-cysteine ligase, modifier subunit, mRNA
NCBI Official Synonym Full Names
glutamate-cysteine ligase modifier subunit
NCBI Official Symbol
GCLM
NCBI Official Synonym Symbols
GLCLR
NCBI Protein Information
glutamate--cysteine ligase regulatory subunit
UniProt Protein Name
Glutamate--cysteine ligase regulatory subunit
UniProt Gene Name
GCLM
UniProt Synonym Gene Names
GLCLR
UniProt Entry Name
GSH0_HUMAN

NCBI Description

Glutamate-cysteine ligase, also known as gamma-glutamylcysteine synthetase, is the first rate limiting enzyme of glutathione synthesis. The enzyme consists of two subunits, a heavy catalytic subunit and a light regulatory subunit. Gamma glutamylcysteine synthetase deficiency has been implicated in some forms of hemolytic anemia. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]

Uniprot Description

GCLM: Glutamate-cysteine ligase, also known as gamma-glutamylcysteine synthetase, is the first rate limiting enzyme of glutathione synthesis. The enzyme consists of two subunits, a heavy catalytic subunit and a light regulatory subunit. Gamma glutamylcysteine synthetase deficiency has been implicated in some forms of hemolytic anemia. [provided by RefSeq, Jul 2008]

Protein type: Other Amino Acids Metabolism - glutathione

Chromosomal Location of Human Ortholog: 1p22.1

Cellular Component: cytosol; glutamate-cysteine ligase complex

Molecular Function: enzyme regulator activity; glutamate-cysteine ligase activity; glutamate-cysteine ligase catalytic subunit binding

Biological Process: glutamate metabolic process; glutathione biosynthetic process; positive regulation of glutamate-cysteine ligase activity; regulation of blood vessel size; response to drug; response to oxidative stress; sulfur amino acid metabolic process

Disease: Myocardial Infarction, Susceptibility To

Research Articles on GCLM

Similar Products

Product Notes

The GCLM gclm (Catalog #AAA1269084) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggcaccg acagccgcgc ggccaaggcg ctcctggcgc gggcccgcac cctgcacctg cagacgggga acctgctgaa ctggggccgc ctgcggaaga agtgcccgtc cacgcacagc gaggagcttc atgattgtat ccaaaaaacc ttgaatgaat ggagttccca aatcaaccca gatttggtca gggagtttcc agatgtcttg gaatgcactg tatctcatgc agtagaaaag ataaatcctg atgaaagaga agaaatgaaa gtttctgcaa aactgttcat tgtagaatca aactcttcat catcaactag aagtgcagtt gacatggcct gttcagtcct tggagttgca cagctggatt ctgtgatcat tgcttcacct cctattgaag atggagttaa tctttccttg gagcatttac agccttactg ggaggaatta gaaaacttag ttcagagcaa aaagattgtt gccataggta cctctgatct agacaaaaca cagttggaac agctgtatca gtgggcacag gtaaaaccaa atagtaacca agttaatctt gcctcctgct gtgtgatgcc accagatttg actgcatttg ctaaacaatt tgacatacag ctgttgactc acaatgatcc aaaagaactg ctttctgaag caagtttcca agaagctctt caggaaagca ttcctgacat tcaagcgcac gagtgggtgc cgctgtggct actgcggtat tcggtcattg tgaaaagtag aggaattatc aaatcaaaag gctacatttt acaagctaaa agaaggggtt cttaa. It is sometimes possible for the material contained within the vial of "GCLM, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.