GCKR cdna clone
GCKR cDNA Clone
Gene Names
GCKR; GKRP; FGQTL5
Synonyms
GCKR; GCKR cDNA Clone; GCKR cdna clone
Sequence
atgccaggcacaaaacggtttcaacatgtcattgagaccccggagcctggcaagtgggagttgtctgggtacgaggcagctgtgccaatcacggagaagtcaaacccactgacccaggatctagacaaagcagatgctgagaacattgttcgactgctagggcaatgtgatgctgagatcttccaggaggaggggcaagccctgtccacataccagagactctacagcgaatccattctgaccaccatggtacaggtggctgggaaagttcaggaagtgctgaaggagccagatggggggctggttgtgctgagtggagggggcacctctggccggatggcattcctcatgtcggtgtcctttaatcagctgatgaaaggtctgggacagaaacctctttacacctacctcattgcaggtggtgacaggtctgtggtggcctctagggaggggacagaagatagtgccttgcacgggattgaggaactgaagaaggtggctgccgggaagaagagagtgattgtcattggcatttctgtgggactctctgctccctttgtggcaggccagatggactgctgcatgaacaacacagctgtcttcttgccagtcctggttggcttcaatccagtgagcatggccagaaatgaccccattgaagactggagttcaacattccgacaagtagcagagcggatgcagaaaatgcaggagaaacagaaagcttttgtgctcaatcctgccatcgggcccgagggtctcagcggctcctcccggatgaaaggtggaagtgccaccaagattctgctggaaaccctgttattagcagcccataagactgtggaccagggcattgcagcatctcaaagatgcctcctggaaatcttgcggacatttgagcgagctcatcaggtgacctacagccaaagccccaagattgccaccctgatgaagagtgtcagcaccagtctggagaagaaaggccacgtgtacctggttggctggcagaccctgggcatcattgccatcatggatggagtagagtgcatccacacctttggtgctgatttccgagatgtccgtggctttctcattggtgatcacagtgacatgtttaaccagaaggctgagctcaccaaccagggtccccagttcaccttctcccaggaggacttcctgacttccatccttccctctctcacggaaatcgatactgtggtcttcattttcaccctggatgacaacctcacggaggtgcagactatagtggagcaggtgaaagagaagaccaaccacatccaggccctggcacacagcaccgtgggtcagaccttgccgatccctctgaagaagctctttccctccatcatcagcatcacatggccactgcttttctttgaatatgaagggaacttcatccagaagttccagcgtgagctaagcaccaaatgggtgctgaatacagtgagtacaggtgctcatgtgcttcttggtaagatcctacaaaaccacatgttggaccttcggattagcaactccaagctcttctggcgggcgctggccatgctgcagcggttctctggacagtccaaggctcgatgcatcgagagcctcctccgagcgatccactttccccagccactgtcagatgatattcgggctgctcccatctcctgccatgtccaggttgcacatgagaaggaacaggtgatacccatcgccttgctgagcctcctattccggtgctcgatcactgaggctcaggcacacctggctgcagctccttctgtctgtgaggctgtcaggagtgctcttgctgggccaggtcagaagcgcactgcggaccccctcgagatcctagagcctgacgttcagtga
Sequence Length
1878
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
16,477 Da
NCBI Official Full Name
Homo sapiens glucokinase (hexokinase 4) regulator, mRNA
NCBI Official Synonym Full Names
glucokinase regulator
NCBI Official Symbol
GCKR
NCBI Official Synonym Symbols
GKRP; FGQTL5
NCBI Protein Information
glucokinase regulatory protein
UniProt Protein Name
Glucokinase regulatory protein
Protein Family
UniProt Gene Name
GCKR
UniProt Synonym Gene Names
GKRP; Glucokinase regulator
UniProt Entry Name
GCKR_HUMAN
NCBI Description
This gene encodes a protein belonging to the GCKR subfamily of the SIS (Sugar ISomerase) family of proteins. The gene product is a regulatory protein that inhibits glucokinase in liver and pancreatic islet cells by binding non-covalently to form an inactive complex with the enzyme. This gene is considered a susceptibility gene candidate for a form of maturity-onset diabetes of the young (MODY). [provided by RefSeq, Jul 2008]
Uniprot Description
GCKR: a key regulator of glucokinase in the liver and pancreas. Not detected in muscle, brain, heart, thymus, intestine, uterus, adipose tissue, kidney, adrenal, lung or spleen. When expressed alone, both glucokinase and GCKR localize predominantly to the cytoplasm. Co-expression induces both proteins to localize in the nucleus.
Protein type: Inhibitor; Mitochondrial
Chromosomal Location of Human Ortholog: 2p23
Cellular Component: cytoplasm; cytosol; nucleoplasm
Molecular Function: protein binding
Biological Process: negative regulation of glucokinase activity; protein import into nucleus, translocation; response to fructose stimulus; urate metabolic process
Disease: Fasting Plasma Glucose Level Quantitative Trait Locus 5
Research Articles on GCKR
1. We found that the PPARGC1A and PNPLA3 variants, but not the GCKR variant, were associated with NASH.
Similar Products
Product Notes
The GCKR gckr (Catalog #AAA1278926) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccaggca caaaacggtt tcaacatgtc attgagaccc cggagcctgg caagtgggag ttgtctgggt acgaggcagc tgtgccaatc acggagaagt caaacccact gacccaggat ctagacaaag cagatgctga gaacattgtt cgactgctag ggcaatgtga tgctgagatc ttccaggagg aggggcaagc cctgtccaca taccagagac tctacagcga atccattctg accaccatgg tacaggtggc tgggaaagtt caggaagtgc tgaaggagcc agatgggggg ctggttgtgc tgagtggagg gggcacctct ggccggatgg cattcctcat gtcggtgtcc tttaatcagc tgatgaaagg tctgggacag aaacctcttt acacctacct cattgcaggt ggtgacaggt ctgtggtggc ctctagggag gggacagaag atagtgcctt gcacgggatt gaggaactga agaaggtggc tgccgggaag aagagagtga ttgtcattgg catttctgtg ggactctctg ctccctttgt ggcaggccag atggactgct gcatgaacaa cacagctgtc ttcttgccag tcctggttgg cttcaatcca gtgagcatgg ccagaaatga ccccattgaa gactggagtt caacattccg acaagtagca gagcggatgc agaaaatgca ggagaaacag aaagcttttg tgctcaatcc tgccatcggg cccgagggtc tcagcggctc ctcccggatg aaaggtggaa gtgccaccaa gattctgctg gaaaccctgt tattagcagc ccataagact gtggaccagg gcattgcagc atctcaaaga tgcctcctgg aaatcttgcg gacatttgag cgagctcatc aggtgaccta cagccaaagc cccaagattg ccaccctgat gaagagtgtc agcaccagtc tggagaagaa aggccacgtg tacctggttg gctggcagac cctgggcatc attgccatca tggatggagt agagtgcatc cacacctttg gtgctgattt ccgagatgtc cgtggctttc tcattggtga tcacagtgac atgtttaacc agaaggctga gctcaccaac cagggtcccc agttcacctt ctcccaggag gacttcctga cttccatcct tccctctctc acggaaatcg atactgtggt cttcattttc accctggatg acaacctcac ggaggtgcag actatagtgg agcaggtgaa agagaagacc aaccacatcc aggccctggc acacagcacc gtgggtcaga ccttgccgat ccctctgaag aagctctttc cctccatcat cagcatcaca tggccactgc ttttctttga atatgaaggg aacttcatcc agaagttcca gcgtgagcta agcaccaaat gggtgctgaa tacagtgagt acaggtgctc atgtgcttct tggtaagatc ctacaaaacc acatgttgga ccttcggatt agcaactcca agctcttctg gcgggcgctg gccatgctgc agcggttctc tggacagtcc aaggctcgat gcatcgagag cctcctccga gcgatccact ttccccagcc actgtcagat gatattcggg ctgctcccat ctcctgccat gtccaggttg cacatgagaa ggaacaggtg atacccatcg ccttgctgag cctcctattc cggtgctcga tcactgaggc tcaggcacac ctggctgcag ctccttctgt ctgtgaggct gtcaggagtg ctcttgctgg gccaggtcag aagcgcactg cggaccccct cgagatccta gagcctgacg ttcagtga. It is sometimes possible for the material contained within the vial of "GCKR, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
