Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GCK cdna clone

GCK cDNA Clone

Gene Names
GCK; GK; GLK; HK4; HHF3; HKIV; HXKP; LGLK; MODY2; FGQTL3
Synonyms
GCK; GCK cDNA Clone; GCK cdna clone
Ordering
For Research Use Only!
Sequence
atgctggacgacagagccaggatggaggccgccaagaaggagaaggtagagcagatcctggcagagttccagctgcaggaggaggacctgaagaaggtgatgagacggatgcagaaggagatggaccgcggcctgaggctggagacccatgaagaggccagtgtgaagatgctgcccacctacgtgcgctccaccccagaaggctcagaagtcggggacttcctctccctggacctgggtggcactaacttcagggtgatgctggtgaaggtgggagaaggtgaggaggggcagtggagcgtgaagaccaaacaccagatgtactccatccccgaggacgccatgaccggcactgctgagatgctcttcgactacatctctgagtgcatctccgacttcctggacaagcatcagatgaaacacaagaagctgcccctgggcttcaccttctcctttcctgtgaggcacgaagacatcgataagggcatccttctcaactggaccaagggcttcaaggcctcaggagcagaagggaacaatgtcgtggggcttctgcgagacgctatcaaacggagaggggactttgaaatggatgtggtggcaatggtgaatgacacggtggccacgatgatctcctgctactacgaagaccatcagtgcgaggtcggcatgatcgtgggcacgggctgcaatgcctgctacatggaggagatgcagaatgtggagctggtggagggggacgagggccgcatgtgcgtcaataccgagtggggcgccttcggggactccggcgagctggacgagttcctgctggagtatgaccgcctggtggacgagagctctgcaaaccccggtcagcagctgtatgagaagctcataggtggcaagtacatgggcgagctggtgcggcttgtgctgctcaggctcgtggacgaaaacctgctcttccacggggaggcctccgagcagctgcgcacacgcggagccttcgagacgcgcttcgtgtcgcaggtggagagcgacacgggcgaccgcaagcagatctacaacatcctgagcacgctggggctgcgaccctcgaccaccgactgcgacatcgtgcgccgcgcctgcgagagcgtgtctacgcgcgctgcgcacatgtgctcggcggggctggcgggcgtcatcaaccgcatgcgcgagagccgcagcgaggacgtaatgcgcatcactgtgggcgtggatggctccgtgtacaagctgcaccccagcttcaaggagcggttccatgccagcgtgcgcaggctgacgcccagctgcgagatcaccttcatcgagtcggaggagggcagtggccggggcgcggccctggtctcggcggtggcctgtaagaaggcctgtatgctgggccagtga
Sequence Length
1398
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
52,035 Da
NCBI Official Full Name
Homo sapiens glucokinase (hexokinase 4), mRNA
NCBI Official Synonym Full Names
glucokinase
NCBI Official Symbol
GCK
NCBI Official Synonym Symbols
GK; GLK; HK4; HHF3; HKIV; HXKP; LGLK; MODY2; FGQTL3
NCBI Protein Information
glucokinase
UniProt Protein Name
Glucokinase
Protein Family
UniProt Gene Name
GCK
UniProt Synonym Gene Names
HK IV; HK4
UniProt Entry Name
HXK4_HUMAN

NCBI Description

Hexokinases phosphorylate glucose to produce glucose-6-phosphate, the first step in most glucose metabolism pathways. Alternative splicing of this gene results in three tissue-specific forms of glucokinase, one found in pancreatic islet beta cells and two found in liver. The protein localizes to the outer membrane of mitochondria. In contrast to other forms of hexokinase, this enzyme is not inhibited by its product glucose-6-phosphate but remains active while glucose is abundant. Mutations in this gene have been associated with non-insulin dependent diabetes mellitus (NIDDM), maturity onset diabetes of the young, type 2 (MODY2) and persistent hyperinsulinemic hypoglycemia of infancy (PHHI). [provided by RefSeq, Apr 2009]

Uniprot Description

GK: a glycolytic enzyme that catalyzes glucose metabolism in the liver and pancreatic beta cells. Acts as a ""glucose sensor"" in beta cells. The first and rate-limiting step in glycosis, a pathway that produces energy in the form of ATP from glucose. Glucokinase traps glucose inside the cell by catalyzing its phosphorylation to produce glucose-6-phosphate. Has a lower affinity for glucose than the three other isozymes of hexokinase, allowing other organs such as the brain and muscles to have first call on glucose when its supply is limited. Unlike other hexokinases, glucokinase is not inhibited by glucose-6-phosphate. Glucokinase is found in the outer membrane compartment of mitochondria. May bind VDAC, suppressing mitochondrial function. Glucokinase transcription is induced by insulin, perhaps via the activation of Stat 5B. Mutant glucokinase causes a rare form of diabetes and may also play a role in type 2 diabetes. Three splice variant isoforms of human glucokinase have been described.

Protein type: Carbohydrate Metabolism - galactose; EC 2.7.1.2; Carbohydrate Metabolism - glycolysis and gluconeogenesis; Kinase, other; Mitochondrial; Carbohydrate Metabolism - starch and sucrose; Carbohydrate Metabolism - amino sugar and nucleotide sugar

Chromosomal Location of Human Ortholog: 7p15.3-p15.1

Cellular Component: cytosol; nucleoplasm

Molecular Function: ATP binding; fructokinase activity; glucokinase activity; glucose binding; mannokinase activity; protein binding

Biological Process: cell glucose homeostasis; cellular response to insulin stimulus; detection of glucose; glucose homeostasis; glucose transport; glycolysis; negative regulation of gluconeogenesis; positive regulation of glycogen biosynthetic process; positive regulation of insulin secretion; regulation of insulin secretion

Disease: Diabetes Mellitus, Noninsulin-dependent; Diabetes Mellitus, Permanent Neonatal; Hyperinsulinemic Hypoglycemia, Familial, 3; Maturity-onset Diabetes Of The Young, Type 2

Research Articles on GCK

Similar Products

Product Notes

The GCK gck (Catalog #AAA1270213) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctggacg acagagccag gatggaggcc gccaagaagg agaaggtaga gcagatcctg gcagagttcc agctgcagga ggaggacctg aagaaggtga tgagacggat gcagaaggag atggaccgcg gcctgaggct ggagacccat gaagaggcca gtgtgaagat gctgcccacc tacgtgcgct ccaccccaga aggctcagaa gtcggggact tcctctccct ggacctgggt ggcactaact tcagggtgat gctggtgaag gtgggagaag gtgaggaggg gcagtggagc gtgaagacca aacaccagat gtactccatc cccgaggacg ccatgaccgg cactgctgag atgctcttcg actacatctc tgagtgcatc tccgacttcc tggacaagca tcagatgaaa cacaagaagc tgcccctggg cttcaccttc tcctttcctg tgaggcacga agacatcgat aagggcatcc ttctcaactg gaccaagggc ttcaaggcct caggagcaga agggaacaat gtcgtggggc ttctgcgaga cgctatcaaa cggagagggg actttgaaat ggatgtggtg gcaatggtga atgacacggt ggccacgatg atctcctgct actacgaaga ccatcagtgc gaggtcggca tgatcgtggg cacgggctgc aatgcctgct acatggagga gatgcagaat gtggagctgg tggaggggga cgagggccgc atgtgcgtca ataccgagtg gggcgccttc ggggactccg gcgagctgga cgagttcctg ctggagtatg accgcctggt ggacgagagc tctgcaaacc ccggtcagca gctgtatgag aagctcatag gtggcaagta catgggcgag ctggtgcggc ttgtgctgct caggctcgtg gacgaaaacc tgctcttcca cggggaggcc tccgagcagc tgcgcacacg cggagccttc gagacgcgct tcgtgtcgca ggtggagagc gacacgggcg accgcaagca gatctacaac atcctgagca cgctggggct gcgaccctcg accaccgact gcgacatcgt gcgccgcgcc tgcgagagcg tgtctacgcg cgctgcgcac atgtgctcgg cggggctggc gggcgtcatc aaccgcatgc gcgagagccg cagcgaggac gtaatgcgca tcactgtggg cgtggatggc tccgtgtaca agctgcaccc cagcttcaag gagcggttcc atgccagcgt gcgcaggctg acgcccagct gcgagatcac cttcatcgag tcggaggagg gcagtggccg gggcgcggcc ctggtctcgg cggtggcctg taagaaggcc tgtatgctgg gccagtga. It is sometimes possible for the material contained within the vial of "GCK, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.