Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GCG cdna clone

GCG cDNA Clone

Gene Names
GCG; GLP1; GLP2; GRPP
Synonyms
GCG; GCG cDNA Clone; GCG cdna clone
Ordering
For Research Use Only!
Sequence
atgaaaagcatttactttgtggctggattatttgtaatgctggtacaaggcagctggcaacgttcccttcaagacacagaggagaaatccagatcattctcagcttcccaggcagacccactcagtgatcctgatcagatgaacgaggacaagcgccattcacagggcacattcaccagtgactacagcaagtatctggactccaggcgtgcccaagattttgtgcagtggttgatgaataccaagaggaacaggaataacattgccaaacgtcacgatgaatttgagagacatgctgaagggacctttaccagtgatgtaagttcttatttggaaggccaagctgccaaggaattcattgcttggctggtgaaaggccgaggaaggcgagatttcccagaagaggtcgccattgttgaagaacttggccgcagacatgctgatggttctttctctgatgagatgaacaccattcttgataatcttgccgccagggactttataaactggttgattcagaccaaaatcactgacaggaaataa
Sequence Length
543
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
20,909 Da
NCBI Official Full Name
Homo sapiens glucagon, mRNA
NCBI Official Synonym Full Names
glucagon
NCBI Official Symbol
GCG
NCBI Official Synonym Symbols
GLP1; GLP2; GRPP
NCBI Protein Information
glucagon
UniProt Protein Name
Glucagon
Protein Family
UniProt Gene Name
GCG
UniProt Synonym Gene Names
GRPP; OXM; OXY; GLP-1; GLP-1(7-37); GLP-1(7-36); GLP-2
UniProt Entry Name
GLUC_HUMAN

NCBI Description

The protein encoded by this gene is actually a preproprotein that is cleaved into four distinct mature peptides. One of these, glucagon, is a pancreatic hormone that counteracts the glucose-lowering action of insulin by stimulating glycogenolysis and gluconeogenesis. Glucagon is a ligand for a specific G-protein linked receptor whose signalling pathway controls cell proliferation. Two of the other peptides are secreted from gut endocrine cells and promote nutrient absorption through distinct mechanisms. Finally, the fourth peptide is similar to glicentin, an active enteroglucagon. [provided by RefSeq, Jul 2008]

Uniprot Description

GCG: Glucagon plays a key role in glucose metabolism and homeostasis. Regulates blood glucose by increasing gluconeogenesis and decreasing glycolysis. A counterregulatory hormone of insulin, raises plasma glucose levels in response to insulin-induced hypoglycemia. Plays an important role in initiating and maintaining hyperglycemic conditions in diabetes. Glucagon release is stimulated by hypoglycemia and inhibited by hyperglycemia, insulin, and somatostatin. GLP-1 and GLP-2 are induced in response to nutrient ingestion. Glucagon is secreted in the A cells of the islets of Langerhans. GLP-1, GLP-2, oxyntomodulin and glicentin are secreted from enteroendocrine cells throughout the gastrointestinal tract. GLP1 and GLP2 are also secreted in selected neurons in the brain. Belongs to the glucagon family.

Protein type: Secreted, signal peptide; Hormone; Secreted

Chromosomal Location of Human Ortholog: 2q36-q37

Cellular Component: endoplasmic reticulum lumen; extracellular region; extracellular space; plasma membrane

Molecular Function: glucagon receptor binding; hormone activity; identical protein binding; protein binding; receptor binding

Biological Process: cell proliferation; feeding behavior; G-protein coupled receptor protein signaling pathway; G-protein signaling, coupled to cAMP nucleotide second messenger; negative regulation of apoptosis; regulation of insulin secretion; response to starvation; signal transduction

Research Articles on GCG

Similar Products

Product Notes

The GCG gcg (Catalog #AAA1274367) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaaagca tttactttgt ggctggatta tttgtaatgc tggtacaagg cagctggcaa cgttcccttc aagacacaga ggagaaatcc agatcattct cagcttccca ggcagaccca ctcagtgatc ctgatcagat gaacgaggac aagcgccatt cacagggcac attcaccagt gactacagca agtatctgga ctccaggcgt gcccaagatt ttgtgcagtg gttgatgaat accaagagga acaggaataa cattgccaaa cgtcacgatg aatttgagag acatgctgaa gggaccttta ccagtgatgt aagttcttat ttggaaggcc aagctgccaa ggaattcatt gcttggctgg tgaaaggccg aggaaggcga gatttcccag aagaggtcgc cattgttgaa gaacttggcc gcagacatgc tgatggttct ttctctgatg agatgaacac cattcttgat aatcttgccg ccagggactt tataaactgg ttgattcaga ccaaaatcac tgacaggaaa taa. It is sometimes possible for the material contained within the vial of "GCG, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.