Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GADD45GIP1 cdna clone

GADD45GIP1 cDNA Clone

Gene Names
GADD45GIP1; PRG6; CRIF1; PLINP; CKBBP2; Plinp1; MRP-L59; PLINP-1; CKbetaBP2
Synonyms
GADD45GIP1; GADD45GIP1 cDNA Clone; GADD45GIP1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggcgtccgtgcgacaggcacgcagcctactaggtgtggcggcgaccctggccccgggttcccgtggctaccgggcgcggccgcccccgcgccgcaggccgggaccccggtggccagaccccgaggacctcctgaccccgcggtggcagctgggaccgcgctacgcggctaagcagttcgcgcgttacggcgccgcctccggggtggtccccggttcgttatggccgtcgccggagcagctgcgggagctggaggccgaagaacgcgaatggtacccgagcctggcgaccatgcaggagtcgctgcgggtgaagcagctggccgaagagcagaagcgtcgggagagggagcagcacatcgcagagtgcatggccaagatgccacagatgattgtgaactggcagcagcagcagcgggagaactgggagaaggcccaggctgacaaggagaggagggcccgactgcaggctgaggcccaggagctcctgggctaccaggtggacccaaggagtgcccgcttccaggagctgctccaggacctagagaagaaggagcgcaagcgcctcaaggaggaaaaacagaaacggaagaaggaggcgcgagctgctgcattggctgcagctgtggctcaagacccagcagcctctggggcacccagctcctga
Sequence Length
669
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
25,384 Da
NCBI Official Full Name
Homo sapiens growth arrest and DNA-damage-inducible, gamma interacting protein 1, mRNA
NCBI Official Synonym Full Names
GADD45G interacting protein 1
NCBI Official Symbol
GADD45GIP1
NCBI Official Synonym Symbols
PRG6; CRIF1; PLINP; CKBBP2; Plinp1; MRP-L59; PLINP-1; CKbetaBP2
NCBI Protein Information
growth arrest and DNA damage-inducible proteins-interacting protein 1
UniProt Protein Name
Growth arrest and DNA damage-inducible proteins-interacting protein 1
UniProt Gene Name
GADD45GIP1
UniProt Synonym Gene Names
MRPL59; PLINP1; PRG6; MRP-L59; CRIF1; PLINP; PLINP-1
UniProt Entry Name
G45IP_HUMAN

NCBI Description

This gene encodes a nuclear-localized protein that may be induced by p53 and regulates the cell cycle by inhibiting G1 to S phase progression. The encoded protein may interact with other cell cycle regulators. [provided by RefSeq, Aug 2012]

Uniprot Description

GADD45GIP1: Acts as a negative regulator of G1 to S cell cycle phase progression by inhibiting cyclin-dependent kinases. Inhibitory effects are additive with GADD45 proteins but occurs also in the absence of GADD45 proteins. Acts as a repressor of the orphan nuclear receptor NR4A1 by inhibiting AB domain-mediated transcriptional activity. May be involved in the hormone-mediated regulation of NR4A1 transcriptional activity. Interacts with GADD45A, GADD45B and GADD45G. Interacts with NR4A1 via the NR4A1 AB domain. Interacts with the human papilloma virus type 16 (HPV 16) minor capsid protein L2. Down-regulated by p53/TP53 in apoptotic cells. Widely expressed. Highly expressed in the thyroid gland, heart, lymph nodes, trachea and adrenal tissues. Expressed at lower level in liver skeletal muscle, kidney, pancreas, testis, ovary and stomach. Barely detectable in adrenal adenoma and papillary thyroid cancer.

Protein type: Cell cycle regulation; Nuclear receptor co-regulator

Chromosomal Location of Human Ortholog: 19p13.2

Cellular Component: mitochondrial matrix; mitochondrion

Molecular Function: protein binding

Research Articles on GADD45GIP1

Similar Products

Product Notes

The GADD45GIP1 gadd45gip1 (Catalog #AAA1270427) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcgt ccgtgcgaca ggcacgcagc ctactaggtg tggcggcgac cctggccccg ggttcccgtg gctaccgggc gcggccgccc ccgcgccgca ggccgggacc ccggtggcca gaccccgagg acctcctgac cccgcggtgg cagctgggac cgcgctacgc ggctaagcag ttcgcgcgtt acggcgccgc ctccggggtg gtccccggtt cgttatggcc gtcgccggag cagctgcggg agctggaggc cgaagaacgc gaatggtacc cgagcctggc gaccatgcag gagtcgctgc gggtgaagca gctggccgaa gagcagaagc gtcgggagag ggagcagcac atcgcagagt gcatggccaa gatgccacag atgattgtga actggcagca gcagcagcgg gagaactggg agaaggccca ggctgacaag gagaggaggg cccgactgca ggctgaggcc caggagctcc tgggctacca ggtggaccca aggagtgccc gcttccagga gctgctccag gacctagaga agaaggagcg caagcgcctc aaggaggaaa aacagaaacg gaagaaggag gcgcgagctg ctgcattggc tgcagctgtg gctcaagacc cagcagcctc tggggcaccc agctcctga. It is sometimes possible for the material contained within the vial of "GADD45GIP1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.