Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

G3BP1 cdna clone

G3BP1 cDNA Clone

Gene Names
G3BP1; G3BP; HDH-VIII
Synonyms
G3BP1; G3BP1 cDNA Clone; G3BP1 cdna clone
Ordering
For Research Use Only!
Sequence
atggtgatggagaagcctagtcccctgctggtcgggcgggaatttgtgagacagtattacacactgctgaaccaggccccagacatgctgcatagattttatggaaagaactcttcttatgtccatgggggattggattcaaatggaaagccagcagatgcagtctacggacagaaagaaatccacaggaaagtgatgtcacaaaacttcaccaactgccacaccaagattcgccatgttgatgctcatgccacgctaaatgatggtgtggtagtccaggtgatggggcttctctctaacaacaaccaggctttgaggagattcatgcaaacgtttgtccttgctcctgaggggtctgttgcaaataaattctatgttcacaatgatatcttcagataccaagatgaggtctttggtgggtttgtcactgagcctcaggaggagtctgaagaagaagtagaggaacctgaagaaagacagcaaacacctgaggtggtacctgatgattctggaactttctatgatcaggcagttgtcagtaatgacatggaagaacatttagaggagcctgttgctgaaccagagcctgatcctgaaccagaaccagaacaagaacctgtatctgaaatccaagaggaaaagcctgagccagtattagaagaaactgcccctgaggatgctcagaagagttcttctccagcacctgcagacatagctcagacagtacaggaagacttgaggacattttcttgggcatctgtgaccagtaagaatcttccacccagtggagctgttccagttactgggataccacctcatgttgttaaagtaccagcttcacagccccgtccagagtctaagcctgaatctcagattccaccacaaagacctcagcgggatcaaagagtgcgagaacaacgaataaatattcctccccaaaggggacccagaccaatccgtgaggctggtgagcaaggtgacattgaaccccgaagaatggtgagacaccctgacagtcaccaactcttcattggcaacctgcctcatgaagtggacaaatcagagcttaaagatttctttcaaagttatggaaacgtggtggagttgcgcattaacagtggtgggaaattacccaattttggttttgttgtgtttgatgattctgagcctgttcagaaagtccttagcaacaggcccatcatgttcagaggtgaggtccgtctgaatgtcgaagagaagaagactcgagctgccagggaaggcgaccgacgagataatcgccttcggggacctggaggccctcgaggtgggctgggtggtggaatgagaggccctccccgtggaggcatggtgcagaaaccaggatttggagtgggaagggggcttgcgccacggcagtga
Sequence Length
1401
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
13,874 Da
NCBI Official Full Name
Homo sapiens GTPase activating protein (SH3 domain) binding protein 1, mRNA
NCBI Official Synonym Full Names
G3BP stress granule assembly factor 1
NCBI Official Symbol
G3BP1
NCBI Official Synonym Symbols
G3BP; HDH-VIII
NCBI Protein Information
ras GTPase-activating protein-binding protein 1
UniProt Protein Name
Ras GTPase-activating protein-binding protein 1
UniProt Gene Name
G3BP1
UniProt Synonym Gene Names
G3BP; G3BP-1; hDH VIII
UniProt Entry Name
G3BP1_HUMAN

NCBI Description

This gene encodes one of the DNA-unwinding enzymes which prefers partially unwound 3'-tailed substrates and can also unwind partial RNA/DNA and RNA/RNA duplexes in an ATP-dependent fashion. This enzyme is a member of the heterogeneous nuclear RNA-binding proteins and is also an element of the Ras signal transduction pathway. It binds specifically to the Ras-GTPase-activating protein by associating with its SH3 domain. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]

Uniprot Description

G3BP-1: an hnRNA-binding protein and endoribonuclease that participates in the Ras signal transduction pathway. A regulated effector of stress granule (SG) assembly. SGs are involved in mRNA sorting in the storing of untranslated mRNAs. Cleaves exclusively between cytosine and adenine and cleaves MYC mRNA preferentially at the 3'-UTR. ATP- and magnesium-dependent helicase. Unwinds preferentially partial DNA and RNA duplexes having a 17 bp annealed portion and either a hanging 3' tail or hanging tails at both 5'- and 3'-ends. Unwinds DNA/DNA, RNA/DNA, and RNA/RNA substrates with comparable efficiency. Acts unidirectionally by moving in the 5' to 3' direction along the bound single-stranded DNA. Binds to the SH3 domain of Ras GTPase-activating protein (RasGAP) in proliferating cells but not in quiescent cells. Cytoplasmic in proliferating cells, can be recruited to the plasma membrane in exponentially growing cells. Cytosolic and partially nuclear in resting cells. Recruited to SGs upon either arsenite or high temperature treatment. RasGAP-dependent phosphorylation of S149 induces a conformational change that prevents self-association. Dephosphorylation after HRAS activation is required for stress granule assembly. S149 phosphorylation induces partial nuclear localization. A component of a TAU mRNP complex, Interacts with USP10, and may regulate it.

Protein type: EC 3.6.4.12; Adaptor/scaffold; RNA-binding; EC 3.6.4.13; Helicase

Chromosomal Location of Human Ortholog: 5q33.1

Cellular Component: cytoplasm; focal adhesion

Molecular Function: ATP-dependent DNA helicase activity; ATP-dependent RNA helicase activity; protein binding

Biological Process: Ras protein signal transduction

Research Articles on G3BP1

Similar Products

Product Notes

The G3BP1 g3bp1 (Catalog #AAA1275064) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtgatgg agaagcctag tcccctgctg gtcgggcggg aatttgtgag acagtattac acactgctga accaggcccc agacatgctg catagatttt atggaaagaa ctcttcttat gtccatgggg gattggattc aaatggaaag ccagcagatg cagtctacgg acagaaagaa atccacagga aagtgatgtc acaaaacttc accaactgcc acaccaagat tcgccatgtt gatgctcatg ccacgctaaa tgatggtgtg gtagtccagg tgatggggct tctctctaac aacaaccagg ctttgaggag attcatgcaa acgtttgtcc ttgctcctga ggggtctgtt gcaaataaat tctatgttca caatgatatc ttcagatacc aagatgaggt ctttggtggg tttgtcactg agcctcagga ggagtctgaa gaagaagtag aggaacctga agaaagacag caaacacctg aggtggtacc tgatgattct ggaactttct atgatcaggc agttgtcagt aatgacatgg aagaacattt agaggagcct gttgctgaac cagagcctga tcctgaacca gaaccagaac aagaacctgt atctgaaatc caagaggaaa agcctgagcc agtattagaa gaaactgccc ctgaggatgc tcagaagagt tcttctccag cacctgcaga catagctcag acagtacagg aagacttgag gacattttct tgggcatctg tgaccagtaa gaatcttcca cccagtggag ctgttccagt tactgggata ccacctcatg ttgttaaagt accagcttca cagccccgtc cagagtctaa gcctgaatct cagattccac cacaaagacc tcagcgggat caaagagtgc gagaacaacg aataaatatt cctccccaaa ggggacccag accaatccgt gaggctggtg agcaaggtga cattgaaccc cgaagaatgg tgagacaccc tgacagtcac caactcttca ttggcaacct gcctcatgaa gtggacaaat cagagcttaa agatttcttt caaagttatg gaaacgtggt ggagttgcgc attaacagtg gtgggaaatt acccaatttt ggttttgttg tgtttgatga ttctgagcct gttcagaaag tccttagcaa caggcccatc atgttcagag gtgaggtccg tctgaatgtc gaagagaaga agactcgagc tgccagggaa ggcgaccgac gagataatcg ccttcgggga cctggaggcc ctcgaggtgg gctgggtggt ggaatgagag gccctccccg tggaggcatg gtgcagaaac caggatttgg agtgggaagg gggcttgcgc cacggcagtg a. It is sometimes possible for the material contained within the vial of "G3BP1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.