Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FUZ cdna clone

FUZ cDNA Clone

Gene Names
FUZ; FY; NTD
Synonyms
FUZ; FUZ cDNA Clone; FUZ cdna clone
Ordering
For Research Use Only!
Sequence
atgggggaggaggggacgggcggcactgtgcatctgctgtgcctcgcggcctccagcggggtccccctattctgcaggagcagtcgcggcggcgcccccgcccgtcagcagctcccgttctctgtcatcggttccctcaatggagtccacatgtttgggcagaatctggaggtgcagctgagctctgcgaggaccgagaacacgactgtggtgtggaaaagcttccatgacagcatcaccctcattgttctgtcatctgaggtgggcatctctgagctgaggctggagagactactccaaatggtgtttggagccatggtccttcttgtgggacttgaagaactgaccaatatccgcaacgtggagagactgaagaaggacttgagggccagttattgcctcatcgacagcttcctgggggactcggagctcatcggggacctgacccagtgtgtggactgcgtgattcctccagaggggtccctcttgcaggaagccctctccgggttcgctgaggccgcgggcacgaccttcgtcagtctggtggtgtccggccgggtggtggcagcaacagagggttggtggcggctggggacgcccgaggccgtgctgctcccctggctggtggggtccctgccgccgcagaccgctcgcgactacccggtgtacctgccgcacgggagccccacggtcccacaccggctcctgaccctgactctgctgccgagcctggagctgtgtctactctgcgggccgagcccacccctcagccagttgtatccacagcttctggagcgctggtggcagccactgctggacccgttgcgggcctgtctgccgttgggaccccgggcgctgcccagtggcttcccccttcacacagacatcctcgggctgctgctcctccacctggaactgaagcgctgcctcttcaccgtggagcccttgggggataaagagccttcaccagaacagcgccggcgcctcctccgaaacttctataccctggtcacctccacgcacttcccaccagagccagggccaccagagaagacagaagatgaggtctaccaggcccagctgcccagagcttgctacctggtgttggggactgaggaaccaggcacaggagtgcgtctggtggccttgcagctggggcttcggcggctgctgctgctgctgtctccccagagtcccacccatgggctgcgaagcctggccacccacactctgcatgccctcaccccacttctttga
Sequence Length
1257
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
41,591 Da
NCBI Official Full Name
Homo sapiens fuzzy homolog (Drosophila), mRNA
NCBI Official Synonym Full Names
fuzzy planar cell polarity protein
NCBI Official Symbol
FUZ
NCBI Official Synonym Symbols
FY; NTD
NCBI Protein Information
protein fuzzy homolog
UniProt Protein Name
Protein fuzzy homolog
Protein Family
UniProt Gene Name
FUZ
UniProt Synonym Gene Names
FY
UniProt Entry Name
FUZZY_HUMAN

NCBI Description

This gene encodes a planar cell polarity protein that is involved in ciliogenesis and directional cell movement. Knockout studies in mice exhibit neural tube defects and defective cilia, and mutations in this gene are associated with neural tube defects in humans. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2012]

Uniprot Description

FUZ: Probable planar cell polarity effector involved in cilium biogenesis. May regulate protein and membrane transport to the cilium. May regulate the morphogenesis of hair follicles which depends on functional primary cilia. Belongs to the fuzzy family. 3 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 19q13.33

Molecular Function: protein binding

Biological Process: embryonic body morphogenesis; embryonic skeletal morphogenesis; establishment of planar polarity; hair follicle development; negative regulation of cell migration; negative regulation of cell proliferation; neural tube closure; positive regulation of flagellum biogenesis; regulation of smoothened signaling pathway

Disease: Neural Tube Defects

Research Articles on FUZ

Similar Products

Product Notes

The FUZ fuz (Catalog #AAA1275729) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggggagg aggggacggg cggcactgtg catctgctgt gcctcgcggc ctccagcggg gtccccctat tctgcaggag cagtcgcggc ggcgcccccg cccgtcagca gctcccgttc tctgtcatcg gttccctcaa tggagtccac atgtttgggc agaatctgga ggtgcagctg agctctgcga ggaccgagaa cacgactgtg gtgtggaaaa gcttccatga cagcatcacc ctcattgttc tgtcatctga ggtgggcatc tctgagctga ggctggagag actactccaa atggtgtttg gagccatggt ccttcttgtg ggacttgaag aactgaccaa tatccgcaac gtggagagac tgaagaagga cttgagggcc agttattgcc tcatcgacag cttcctgggg gactcggagc tcatcgggga cctgacccag tgtgtggact gcgtgattcc tccagagggg tccctcttgc aggaagccct ctccgggttc gctgaggccg cgggcacgac cttcgtcagt ctggtggtgt ccggccgggt ggtggcagca acagagggtt ggtggcggct ggggacgccc gaggccgtgc tgctcccctg gctggtgggg tccctgccgc cgcagaccgc tcgcgactac ccggtgtacc tgccgcacgg gagccccacg gtcccacacc ggctcctgac cctgactctg ctgccgagcc tggagctgtg tctactctgc gggccgagcc cacccctcag ccagttgtat ccacagcttc tggagcgctg gtggcagcca ctgctggacc cgttgcgggc ctgtctgccg ttgggacccc gggcgctgcc cagtggcttc ccccttcaca cagacatcct cgggctgctg ctcctccacc tggaactgaa gcgctgcctc ttcaccgtgg agcccttggg ggataaagag ccttcaccag aacagcgccg gcgcctcctc cgaaacttct ataccctggt cacctccacg cacttcccac cagagccagg gccaccagag aagacagaag atgaggtcta ccaggcccag ctgcccagag cttgctacct ggtgttgggg actgaggaac caggcacagg agtgcgtctg gtggccttgc agctggggct tcggcggctg ctgctgctgc tgtctcccca gagtcccacc catgggctgc gaagcctggc cacccacact ctgcatgccc tcaccccact tctttga. It is sometimes possible for the material contained within the vial of "FUZ, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.