Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FSHB cdna clone

FSHB cDNA Clone

Gene Names
FSHB; HH24
Synonyms
FSHB; FSHB cDNA Clone; FSHB cdna clone
Ordering
For Research Use Only!
Sequence
atgaagacactccagtttttcttccttttctgttgctggaaagcaatctgctgcaatagctgtgagctgaccaacatcaccattgcaatagagaaagaagaatgtcgtttctgcataagcatcaacaccacttggtgtgctggctactgctacaccagggatctggtgtataaggacccagccaggcccaaaatccagaaaacatgtaccttcaaggaactggtatacgaaacagtgagagtgcccggctgtgctcaccatgcagattccttgtatacatacccagtggccacccagtgtcactgtggcaagtgtgacagcgacagcactgattgtactgtgcgaggcctggggcccagctactgctcctttggtgaaatgaaagaataa
Sequence Length
390
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
14,700 Da
NCBI Official Full Name
Homo sapiens follicle stimulating hormone, beta polypeptide, mRNA
NCBI Official Synonym Full Names
follicle stimulating hormone beta subunit
NCBI Official Symbol
FSHB
NCBI Official Synonym Symbols
HH24
NCBI Protein Information
follitropin subunit beta
UniProt Protein Name
Follitropin subunit beta
Protein Family
UniProt Gene Name
FSHB
UniProt Synonym Gene Names
FSH-B; FSH-beta
UniProt Entry Name
FSHB_HUMAN

NCBI Description

The pituitary glycoprotein hormone family includes follicle-stimulating hormone, luteinizing hormone, chorionic gonadotropin, and thyroid-stimulating hormone. All of these glycoproteins consist of an identical alpha subunit and a hormone-specific beta subunit. This gene encodes the beta subunit of follicle-stimulating hormone. In conjunction with luteinizing hormone, follicle-stimulating hormone induces egg and sperm production. Alternative splicing results in two transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]

Uniprot Description

FSHB: Stimulates development of follicle and spermatogenesis in the reproductive organs. Defects in FSHB are a cause of isolated follicle- stimulating hormone deficiency (IFSHD). Selective follicle-stimulating hormone deficiency is an uncommon cause of infertility, producing amenorrhea and hypogonadism in women and oligo or azoospermia with normal testosterone levels in normally virilised men. Belongs to the glycoprotein hormones subunit beta family.

Protein type: Secreted, signal peptide; Secreted

Chromosomal Location of Human Ortholog: 11p13

Cellular Component: cytoplasm; extracellular region

Molecular Function: follicle-stimulating hormone activity; hormone activity; protein binding

Biological Process: female gamete generation; female pregnancy; peptide hormone processing; progesterone biosynthetic process; signal transduction; transforming growth factor beta receptor signaling pathway

Disease: Follicle-stimulating Hormone Deficiency, Isolated

Research Articles on FSHB

Similar Products

Product Notes

The FSHB fshb (Catalog #AAA1270361) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagacac tccagttttt cttccttttc tgttgctgga aagcaatctg ctgcaatagc tgtgagctga ccaacatcac cattgcaata gagaaagaag aatgtcgttt ctgcataagc atcaacacca cttggtgtgc tggctactgc tacaccaggg atctggtgta taaggaccca gccaggccca aaatccagaa aacatgtacc ttcaaggaac tggtatacga aacagtgaga gtgcccggct gtgctcacca tgcagattcc ttgtatacat acccagtggc cacccagtgt cactgtggca agtgtgacag cgacagcact gattgtactg tgcgaggcct ggggcccagc tactgctcct ttggtgaaat gaaagaataa. It is sometimes possible for the material contained within the vial of "FSHB, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.