Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FOXP2 cdna clone

FOXP2 cDNA Clone

Gene Names
FOXP2; SPCH1; CAGH44; TNRC10
Synonyms
FOXP2; FOXP2 cDNA Clone; FOXP2 cdna clone
Ordering
For Research Use Only!
Sequence
atgatgcaggaatctgcgacagagacaataagcaacagttcaatgaatcaaaatggaatgagcactctaagcagccaattagatgctggcagcagagatggaagatcaagtggtgacaccagctctgaagtaagcacagtagaactgctgcatctgcaacaacagcaggaggatgttgtctcttacacccaggttatttgttaa
Sequence Length
204
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
79,919 Da
NCBI Official Full Name
Homo sapiens forkhead box P2, mRNA
NCBI Official Synonym Full Names
forkhead box P2
NCBI Official Symbol
FOXP2
NCBI Official Synonym Symbols
SPCH1; CAGH44; TNRC10
NCBI Protein Information
forkhead box protein P2; CAG repeat protein 44; trinucleotide repeat containing 10; forkhead/winged-helix transcription factor; trinucleotide repeat-containing gene 10 protein
UniProt Protein Name
Forkhead box protein P2
Protein Family
UniProt Gene Name
FOXP2
UniProt Synonym Gene Names
CAGH44; TNRC10
UniProt Entry Name
FOXP2_HUMAN

NCBI Description

This gene encodes a member of the forkhead/winged-helix (FOX) family of transcription factors. It is expressed in fetal and adult brain as well as in several other organs such as the lung and gut. The protein product contains a FOX DNA-binding domain and a large polyglutamine tract and is an evolutionarily conserved transcription factor, which may bind directly to approximately 300 to 400 gene promoters in the human genome to regulate the expression of a variety of genes. This gene is required for proper development of speech and language regions of the brain during embryogenesis, and may be involved in a variety of biological pathways and cascades that may ultimately influence language development. Mutations in this gene cause speech-language disorder 1 (SPCH1), also known as autosomal dominant speech and language disorder with orofacial dyspraxia. Multiple alternative transcripts encoding different isoforms have been identified in this gene.[provided by RefSeq, Feb 2010]

Uniprot Description

FOXP2: Transcriptional repressor that may play a role in the specification and differentiation of lung epithelium. May also play a role in developing neural, gastrointestinal and cardiovascular tissues. Can act with CTBP1 to synergistically repress transcription but CTPBP1 is not essential. Involved in neural mechanisms mediating the development of speech and language. Forms homodimers and heterodimers with FOXP1 and FOXP4. Dimerization is required for DNA-binding. Interacts with CTBP1. Isoform 1 and isoform 6 are expressed in adult and fetal brain, caudate nucleus and lung. 9 isoforms of the human protein are produced by alternative splicing.

Protein type: DNA-binding; C2H2-type zinc finger protein

Chromosomal Location of Human Ortholog: 7q31

Cellular Component: nucleus

Molecular Function: protein binding; protein homodimerization activity; DNA binding; sequence-specific DNA binding; protein heterodimerization activity; metal ion binding; transcription factor activity

Biological Process: caudate nucleus development; skeletal muscle development; camera-type eye development; transcription, DNA-dependent; righting reflex; putamen development; negative regulation of transcription from RNA polymerase II promoter; vocal learning; post-embryonic development; smooth muscle development; positive regulation of mesenchymal cell proliferation; cerebellum development; cerebral cortex development; negative regulation of transcription, DNA-dependent; alveolus development; growth

Disease: Speech-language Disorder 1

Research Articles on FOXP2

Similar Products

Product Notes

The FOXP2 foxp2 (Catalog #AAA1274981) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatgcagg aatctgcgac agagacaata agcaacagtt caatgaatca aaatggaatg agcactctaa gcagccaatt agatgctggc agcagagatg gaagatcaag tggtgacacc agctctgaag taagcacagt agaactgctg catctgcaac aacagcagga ggatgttgtc tcttacaccc aggttatttg ttaa. It is sometimes possible for the material contained within the vial of "FOXP2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.