Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FOS cdna clone

FOS cDNA Clone

Gene Names
FOS; p55; AP-1; C-FOS
Synonyms
FOS; FOS cDNA Clone; FOS cdna clone
Ordering
For Research Use Only!
Sequence
atgatgttctcgggcttcaacgcagactacgaggcgtcatcctcccgctgcagcagcgcgtccccggccggggatagcctctcttactaccactcacccgcagactccttctccagcatgggctcgcctgtcaacgcgcaggacttctgcacggacctggccgtctccagtgccaacttcattcccacggtcactgccatctcgaccagtccggacctgcagtggctggtgcagcccgccctcgtctcctctgtggccccatcgcagaccagagcccctcaccctttcggagtccccgccccctccgctggggcttactccagggctggcgttgtgaagaccatgacaggaggccgagcgcagagcattggcaggaggggcaaggtggaacagttatctccagaagaagaagagaaaaggagaatccgaagggaaaggaataagatggctgcagccaaatgccgcaaccggaggagggagctgactgatacactccaagcggagacagaccaactagaagatgagaagtctgctttgcagaccgagattgccaacctgctgaaggagaaggaaaaactagagttcatcctggcagctcaccgacctgcctgcaagatccctgatgacctgggcttcccagaagagatgtctgtggcttcccttgatctgactgggggcctgccagaggttgccaccccggagtctgaggaggccttcaccctgcctctcctcaatgaccctgagcccaagccctcagtggaacctgtcaagagcatcagcagcatggagctgaagaccgagccctttgatgacttcctgttcccagcatcatccaggcccagtggctctgagacagcccgctccgtgccagacatggacctatctgggtccttctatgcagcagactgggagcctctgcacagtggctccctggggatggggcccatggccacagagctggagcccctgtgcactccggtggtcacctgtactcccagctgcactgcttacacgtcttccttcgtcttcacctaccccgaggctgactccttccccagctgtgcagctgcccaccgcaagggcagcagcagcaatgagccttcctctgactcgctcagctcacccacgctgctggccctgtga
Sequence Length
1143
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
36,301 Da
NCBI Official Full Name
Homo sapiens v-fos FBJ murine osteosarcoma viral oncogene homolog, mRNA
NCBI Official Synonym Full Names
Fos proto-oncogene, AP-1 transcription factor subunit
NCBI Official Symbol
FOS
NCBI Official Synonym Symbols
p55; AP-1; C-FOS
NCBI Protein Information
proto-oncogene c-Fos
UniProt Protein Name
Proto-oncogene c-Fos
Protein Family
UniProt Gene Name
FOS
UniProt Synonym Gene Names
G0S7
UniProt Entry Name
FOS_HUMAN

NCBI Description

The Fos gene family consists of 4 members: FOS, FOSB, FOSL1, and FOSL2. These genes encode leucine zipper proteins that can dimerize with proteins of the JUN family, thereby forming the transcription factor complex AP-1. As such, the FOS proteins have been implicated as regulators of cell proliferation, differentiation, and transformation. In some cases, expression of the FOS gene has also been associated with apoptotic cell death. [provided by RefSeq, Jul 2008]

Uniprot Description

Fos: a proto-oncogenic transcription factor of the bZIP family. Dimerizes with proteins of the JUN family, thereby forming the transcription factor complex AP-1. FOS proteins function as regulators of cell proliferation, differentiation, and transformation. In some cases, expression of FOS has also been associated with apoptotic cell death. Expression increases upon a variety of stimuli, including growth factors, cytokines, neurotransmitters, polypeptide hormones, stress and cell injury.

Protein type: DNA-binding; Motility/polarity/chemotaxis; Oncoprotein; Transcription factor

Chromosomal Location of Human Ortholog: 14q24.3

Cellular Component: nucleoplasm; nucleus

Molecular Function: protein binding; transcription factor activity; transcription factor binding

Biological Process: DNA methylation; inflammatory response; positive regulation of transcription from RNA polymerase II promoter; positive regulation of transcription, DNA-dependent; regulation of transcription factor activity; regulation of transcription from RNA polymerase II promoter; transforming growth factor beta receptor signaling pathway

Research Articles on FOS

Similar Products

Product Notes

The FOS fos (Catalog #AAA1270804) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatgttct cgggcttcaa cgcagactac gaggcgtcat cctcccgctg cagcagcgcg tccccggccg gggatagcct ctcttactac cactcacccg cagactcctt ctccagcatg ggctcgcctg tcaacgcgca ggacttctgc acggacctgg ccgtctccag tgccaacttc attcccacgg tcactgccat ctcgaccagt ccggacctgc agtggctggt gcagcccgcc ctcgtctcct ctgtggcccc atcgcagacc agagcccctc accctttcgg agtccccgcc ccctccgctg gggcttactc cagggctggc gttgtgaaga ccatgacagg aggccgagcg cagagcattg gcaggagggg caaggtggaa cagttatctc cagaagaaga agagaaaagg agaatccgaa gggaaaggaa taagatggct gcagccaaat gccgcaaccg gaggagggag ctgactgata cactccaagc ggagacagac caactagaag atgagaagtc tgctttgcag accgagattg ccaacctgct gaaggagaag gaaaaactag agttcatcct ggcagctcac cgacctgcct gcaagatccc tgatgacctg ggcttcccag aagagatgtc tgtggcttcc cttgatctga ctgggggcct gccagaggtt gccaccccgg agtctgagga ggccttcacc ctgcctctcc tcaatgaccc tgagcccaag ccctcagtgg aacctgtcaa gagcatcagc agcatggagc tgaagaccga gccctttgat gacttcctgt tcccagcatc atccaggccc agtggctctg agacagcccg ctccgtgcca gacatggacc tatctgggtc cttctatgca gcagactggg agcctctgca cagtggctcc ctggggatgg ggcccatggc cacagagctg gagcccctgt gcactccggt ggtcacctgt actcccagct gcactgctta cacgtcttcc ttcgtcttca cctaccccga ggctgactcc ttccccagct gtgcagctgc ccaccgcaag ggcagcagca gcaatgagcc ttcctctgac tcgctcagct cacccacgct gctggccctg tga. It is sometimes possible for the material contained within the vial of "FOS, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.