FMO4 cdna clone
FMO4 cDNA Clone
Gene Names
FMO4; FMO2
Synonyms
FMO4; FMO4 cDNA Clone; FMO4 cdna clone
Sequence
atggccaagaaagttgcagtgattggagctggtgtgagtggcctctcctccatcaaatgctgtgtggatgaggacctggagcccacctgctttgagagaagtgatgacattgggggattatggaagtttactgaatcttccaaagatgggatgaccagggtctataagtcattagtgacaaatgtctgtaaggaaatgtcatgttacagtgacttccctttccacgaagattatcctaatttcatgaaccatgaaaaattttgggactatctccaagaatttgctgagcactttgacctcctgaaatacattcagtttaagaccactgtgtgcagcataacgaagcgtccagacttctccgaaactggtcagtgggatgttgtcacagagacagagggcaagcaaaatagagctgtctttgatgctgttatggtttgcactggacatttcctgaatccccatttacctttggaagcctttcctggaattcataagtttaaaggtcagatcctgcatagtcaagagtacaagatcccagaaggctttcagggcaaacgcgtcttggtgattggtcttgggaacactggaggagacattgctgtggaactcagtcgaacggcagctcaggtacttctcagtactagaactggtacctgggttcttgggcgctcttcagattggggctatccttataatatgatggttacaagaagatgctgtagttttattgcacaagttctgccttcacgttttctaaactggattcaagaaaggaagttgaataagagatttaatcatgaggattatggattaagtattaccaaagggaaaaaagcaaaattcattgtgaatgatgagctgccaaactgtatcctctgtggggcaatcactatgaaaaccagcgtgattgaatttacagaaacctctgctgtctttgaagatgggacagtggaagaaaacattgatgttgtgatcttcactacaggatatacattttcttttccattttttgaagaacctcttaaaagcctctgtacaaagaagatatttctatacaagcaagtctttcccttaaacctagagagagcgacattagccatcatcggccttatcggccttaaaggatccatcttatcaggcacagagctccaagcacgatgggtcacaagagtattcaaaggactctgtaagatacctccatcccaaaaattgatgatggaggctactgaaaaggaacagctcattaaaaggggagtgtttaaagacaccagcaaagacaaatttgactacattgcctacatggatgatatcgctgcctgcataggcacaaagcccagcatcccacttctgttcctcaaggatcccagactagcttgggaagttttctttggaccatgtactccttatcagtaccgcctcatgggccctggaaaatgggatggagccagaaatgccatcctgacccagtgggacagaacattgaaacctttaaaaactcgaattgtccctgattcctccaagcctgcctccatgtcacattatttaaaagcctggggggcacctgtcctacttgcctctcttctacttatctgtaaatcttcacttttcttgaaattggtgagagataaactacaggacagaatgtccccttacctagtaagtctttggcgaggatga
Sequence Length
1677
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
63,343 Da
NCBI Official Full Name
Homo sapiens flavin containing monooxygenase 4, mRNA
NCBI Official Synonym Full Names
flavin containing monooxygenase 4
NCBI Official Symbol
FMO4
NCBI Official Synonym Symbols
FMO2
NCBI Protein Information
dimethylaniline monooxygenase [N-oxide-forming] 4
UniProt Protein Name
Dimethylaniline monooxygenase [N-oxide-forming] 4
Protein Family
UniProt Gene Name
FMO4
UniProt Synonym Gene Names
FMO2; FMO 4
UniProt Entry Name
FMO4_HUMAN
NCBI Description
Metabolic N-oxidation of diet-derived amino-trimethylamine (TMA) is mediated by flavin-containing monooxygenase and is subject to an inherited FMO3 polymorphism in man. This results in a small subpopulation with reduced TMA N-oxidation capacity and causes fish odor syndrome (Trimethylaminuria). Three forms of the enzyme are encoded by genes clustered in the 1q23-q25 region. Flavin-containing monooxygenases are NADPH-dependent flavoenzymes that catalyzes the oxidation of soft nucleophilic heteroatom centers in drugs, pesticides, and xenobiotics. [provided by RefSeq, Jan 2015]
Uniprot Description
FMO4: This protein is involved in the oxidative metabolism of a variety of xenobiotics such as drugs and pesticides. Belongs to the FMO family.
Protein type: Xenobiotic Metabolism - drug metabolism - cytochrome P450; Oxidoreductase; EC 1.14.13.8; Membrane protein, integral
Chromosomal Location of Human Ortholog: 1q24.3
Molecular Function: flavin-containing monooxygenase activity
Biological Process: drug metabolic process
Research Articles on FMO4
Similar Products
Product Notes
The FMO4 fmo4 (Catalog #AAA1278118) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccaaga aagttgcagt gattggagct ggtgtgagtg gcctctcctc catcaaatgc tgtgtggatg aggacctgga gcccacctgc tttgagagaa gtgatgacat tgggggatta tggaagttta ctgaatcttc caaagatggg atgaccaggg tctataagtc attagtgaca aatgtctgta aggaaatgtc atgttacagt gacttccctt tccacgaaga ttatcctaat ttcatgaacc atgaaaaatt ttgggactat ctccaagaat ttgctgagca ctttgacctc ctgaaataca ttcagtttaa gaccactgtg tgcagcataa cgaagcgtcc agacttctcc gaaactggtc agtgggatgt tgtcacagag acagagggca agcaaaatag agctgtcttt gatgctgtta tggtttgcac tggacatttc ctgaatcccc atttaccttt ggaagccttt cctggaattc ataagtttaa aggtcagatc ctgcatagtc aagagtacaa gatcccagaa ggctttcagg gcaaacgcgt cttggtgatt ggtcttggga acactggagg agacattgct gtggaactca gtcgaacggc agctcaggta cttctcagta ctagaactgg tacctgggtt cttgggcgct cttcagattg gggctatcct tataatatga tggttacaag aagatgctgt agttttattg cacaagttct gccttcacgt tttctaaact ggattcaaga aaggaagttg aataagagat ttaatcatga ggattatgga ttaagtatta ccaaagggaa aaaagcaaaa ttcattgtga atgatgagct gccaaactgt atcctctgtg gggcaatcac tatgaaaacc agcgtgattg aatttacaga aacctctgct gtctttgaag atgggacagt ggaagaaaac attgatgttg tgatcttcac tacaggatat acattttctt ttccattttt tgaagaacct cttaaaagcc tctgtacaaa gaagatattt ctatacaagc aagtctttcc cttaaaccta gagagagcga cattagccat catcggcctt atcggcctta aaggatccat cttatcaggc acagagctcc aagcacgatg ggtcacaaga gtattcaaag gactctgtaa gatacctcca tcccaaaaat tgatgatgga ggctactgaa aaggaacagc tcattaaaag gggagtgttt aaagacacca gcaaagacaa atttgactac attgcctaca tggatgatat cgctgcctgc ataggcacaa agcccagcat cccacttctg ttcctcaagg atcccagact agcttgggaa gttttctttg gaccatgtac tccttatcag taccgcctca tgggccctgg aaaatgggat ggagccagaa atgccatcct gacccagtgg gacagaacat tgaaaccttt aaaaactcga attgtccctg attcctccaa gcctgcctcc atgtcacatt atttaaaagc ctggggggca cctgtcctac ttgcctctct tctacttatc tgtaaatctt cacttttctt gaaattggtg agagataaac tacaggacag aatgtcccct tacctagtaa gtctttggcg aggatga. It is sometimes possible for the material contained within the vial of "FMO4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
