Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FMO3 cdna clone

FMO3 cDNA Clone

Gene Names
FMO3; TMAU; FMOII; dJ127D3.1
Synonyms
FMO3; FMO3 cDNA Clone; FMO3 cdna clone
Ordering
For Research Use Only!
Sequence
atggggaagaaagtggccatcattggagctggtgtgagtggcttggcctccatcaggagctgtctggaagaggggctggagcccacctgctttgagaagagcaatgacattgggggcctgtggaaattttcagaccatgcagaggagggcagggctagcatttacaaatcagtcttttccaactcttccaaagagatgatgtgtttcccagacttcccatttcccgatgacttccccaactttatgcacaacagcaagatccaggaatatatcattgcatttgccaaagaaaagaacctcctgaagtacatacaatttaagacatttgtatccagtgtaaataaacatcctgattttgcaactactggccagtgggatgttaccactgaaagggatggtaaaaaagaatcggctgtctttgatgctgtaatggtttgttccggacatcatgtgtatcccaacctaccaaaagagtcctttccaggactaaaccactttaaaggcaaatgcttccacagcagggactataaagaaccaggtgtattcaatggaaagcgtgtcctggtggttggcctggggaattcgggctgtgatattgccacagaactcagccgcacagcagaacaggtcatgatcagttccagaagtggctcctgggtgatgagccgggtctgggacaatggttatccttgggacatgctgctcgtcactcgatttggaaccttcctcaagaacaatttaccgacagccatctctgactggttgtacatgaagcagatgaatgcaagattcaagcatgaaaactatggcttgatgcctttaaatggagtcctgaggaaagagcctgtatttaacgatgagctcccagcaagcattctgtgtggcattgtgtccgtaaagcctaacgtgaaggaattcacagagacctcggccatttttgaggatgggaccatatttgagggcattgactgtgtaatctttgcaacagggtatagttttgcctaccccttccttgatgagtctatcatcaaaagcagaaacaatgagatcattttatttaaaggagtatttcctcctctacttgagaagtcaaccatagcagtgattggctttgtccagtcccttggggctgccattcccacagttgacctccagtcccgctgggcagcacaagtaataaagggaacttgtactttgccttctatggaagacatgatgaatgatattaatgagaaaatggagaaaaagcgcaaatggtttggcaaaagcgagaccatacagacagattacattgtttatatggatgaactctcctccttcattggggcaaagcccaacatcccatggctgtttctcacagatcccaaattggccatggaagtttattttggcccttgtagtccctaccagtttaggctggtgggcccagggcagtggccaggagccagaaatgccatactgacccagtgggaccggtcgttgaaacccatgcagacacgagtggtcgggagacttcagaagccttgcttctttttccattggctgaagctctttgcaattcctattctgttaatcgctgttttccttgtgttgacctaa
Sequence Length
1599
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
60,033 Da
NCBI Official Full Name
Homo sapiens flavin containing monooxygenase 3, mRNA
NCBI Official Synonym Full Names
flavin containing monooxygenase 3
NCBI Official Symbol
FMO3
NCBI Official Synonym Symbols
TMAU; FMOII; dJ127D3.1
NCBI Protein Information
dimethylaniline monooxygenase [N-oxide-forming] 3
UniProt Protein Name
Dimethylaniline monooxygenase [N-oxide-forming] 3
UniProt Gene Name
FMO3
UniProt Synonym Gene Names
FMO 3
UniProt Entry Name
FMO3_HUMAN

NCBI Description

Flavin-containing monooxygenases (FMO) are an important class of drug-metabolizing enzymes that catalyze the NADPH-dependent oxygenation of various nitrogen-,sulfur-, and phosphorous-containing xenobiotics such as therapeutic drugs, dietary compounds, pesticides, and other foreign compounds. The human FMO gene family is composed of 5 genes and multiple pseudogenes. FMO members have distinct developmental- and tissue-specific expression patterns. The expression of this FMO3 gene, the major FMO expressed in adult liver, can vary up to 20-fold between individuals. This inter-individual variation in FMO3 expression levels is likely to have significant effects on the rate at which xenobiotics are metabolised and, therefore, is of considerable interest to the pharmaceutical industry. This transmembrane protein localizes to the endoplasmic reticulum of many tissues. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. Mutations in this gene cause the disorder trimethylaminuria (TMAu) which is characterized by the accumulation and excretion of unmetabolized trimethylamine and a distinctive body odor. In healthy individuals, trimethylamine is primarily converted to the non odorous trimethylamine N-oxide.[provided by RefSeq, Jan 2016]

Uniprot Description

FMO3: Involved in the oxidative metabolism of a variety of xenobiotics such as drugs and pesticides. It N-oxygenates primary aliphatic alkylamines as well as secondary and tertiary amines. Plays an important role in the metabolism of trimethylamine (TMA), via the production of TMA N-oxide (TMAO). Is also able to perform S-oxidation when acting on sulfide compounds. Defects in FMO3 are the cause of trimethylaminuria (TMAU); also known as fish-odor syndrome. TMAU is an inborn error of metabolism associated with an offensive body odor and caused by deficiency of FMO-mediated N-oxidation of amino- trimethylamine (TMA) derived from foodstuffs. Such individuals excrete relatively large amounts of TMA in their urine, sweat, and breath, and exhibit a fishy body odor characteristic of the malodorous free amine. Belongs to the FMO family.

Protein type: EC 1.14.13.148; Oxidoreductase; Xenobiotic Metabolism - drug metabolism - cytochrome P450; EC 1.14.13.8

Chromosomal Location of Human Ortholog: 1q24.3

Cellular Component: endoplasmic reticulum membrane; intracellular membrane-bound organelle

Molecular Function: flavin-containing monooxygenase activity; monooxygenase activity

Biological Process: xenobiotic metabolic process

Disease: Trimethylaminuria

Research Articles on FMO3

Similar Products

Product Notes

The FMO3 fmo3 (Catalog #AAA1267019) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggggaaga aagtggccat cattggagct ggtgtgagtg gcttggcctc catcaggagc tgtctggaag aggggctgga gcccacctgc tttgagaaga gcaatgacat tgggggcctg tggaaatttt cagaccatgc agaggagggc agggctagca tttacaaatc agtcttttcc aactcttcca aagagatgat gtgtttccca gacttcccat ttcccgatga cttccccaac tttatgcaca acagcaagat ccaggaatat atcattgcat ttgccaaaga aaagaacctc ctgaagtaca tacaatttaa gacatttgta tccagtgtaa ataaacatcc tgattttgca actactggcc agtgggatgt taccactgaa agggatggta aaaaagaatc ggctgtcttt gatgctgtaa tggtttgttc cggacatcat gtgtatccca acctaccaaa agagtccttt ccaggactaa accactttaa aggcaaatgc ttccacagca gggactataa agaaccaggt gtattcaatg gaaagcgtgt cctggtggtt ggcctgggga attcgggctg tgatattgcc acagaactca gccgcacagc agaacaggtc atgatcagtt ccagaagtgg ctcctgggtg atgagccggg tctgggacaa tggttatcct tgggacatgc tgctcgtcac tcgatttgga accttcctca agaacaattt accgacagcc atctctgact ggttgtacat gaagcagatg aatgcaagat tcaagcatga aaactatggc ttgatgcctt taaatggagt cctgaggaaa gagcctgtat ttaacgatga gctcccagca agcattctgt gtggcattgt gtccgtaaag cctaacgtga aggaattcac agagacctcg gccatttttg aggatgggac catatttgag ggcattgact gtgtaatctt tgcaacaggg tatagttttg cctacccctt ccttgatgag tctatcatca aaagcagaaa caatgagatc attttattta aaggagtatt tcctcctcta cttgagaagt caaccatagc agtgattggc tttgtccagt cccttggggc tgccattccc acagttgacc tccagtcccg ctgggcagca caagtaataa agggaacttg tactttgcct tctatggaag acatgatgaa tgatattaat gagaaaatgg agaaaaagcg caaatggttt ggcaaaagcg agaccataca gacagattac attgtttata tggatgaact ctcctccttc attggggcaa agcccaacat cccatggctg tttctcacag atcccaaatt ggccatggaa gtttattttg gcccttgtag tccctaccag tttaggctgg tgggcccagg gcagtggcca ggagccagaa atgccatact gacccagtgg gaccggtcgt tgaaacccat gcagacacga gtggtcggga gacttcagaa gccttgcttc tttttccatt ggctgaagct ctttgcaatt cctattctgt taatcgctgt tttccttgtg ttgacctaa. It is sometimes possible for the material contained within the vial of "FMO3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.